WormMine: Gene WBGene00017895

• WormBase Gene ID: WBGene00017895
• Gene Name: vrk-1
• Sequence Name: F28B12.3
• Brief Description: vrk-1 encodes the ortholog of the vaccinia-related protein kinases in metazoans; vrk-1 is required for normal mitosis, proper nuclear envelope formation and regulates the association of the LEM domain protein BAF-1/Barrier-to-autointegration factor (and possibly other LEM domain proteins) with chromatin via BAF-1 phosphorylation; vrk-1 is required for germ cell proliferation and acts in part through regulation of CEP-1/p53; vrk-1 is also required for development of the egg-laying system including several processes like formation of the vulva, the specification and proliferation of uterine cells and sex myoblasts, and anchor cell invasion of the basement membrane between the vulva and somatic gonad; VRK-1 is expressed in neurons, hypodermal cells and vulval cells, and localizes to the nuclear envelope and chromatin in a cell-cylce dependent manner.
• Organism: Caenorhabditis elegans
• Automated Description: Enables protein serine/threonine kinase activity. Involved in several processes, including cell fate specification; gonad development; and regulation of fibroblast growth factor receptor signaling pathway. Located in nuclear envelope. Part of chromatin. Expressed in several structures, including P3.p hermaphrodite; P4.p hermaphrodite; P8.p hermaphrodite; hermaphrodite gonad; and ventral nerve cord. Human ortholog(s) of this gene implicated in autosomal recessive distal hereditary motor neuronopathy 10 and pontocerebellar hypoplasia type 1A. Is an ortholog of human VRK1 (VRK serine/threonine kinase 1).
• Biotype: SO:0001217
• Genetic Position: II :-0.846215 ±0.001787
• Length (nt): 2872

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00017895

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F28B12.3.1	F28B12.3.1	2218	II: 5921967-5924838
Transcript:F28B12.3.2	F28B12.3.2	2213	II: 5921971-5924837

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F28B12.3	F28B12.3	1833	II: 5921972-5922454

18 RNAi Result

• WBRNAi00070438
• WBRNAi00065796
• WBRNAi00081724
• WBRNAi00082714
• WBRNAi00065795
• WBRNAi00108290
• WBRNAi00065794
• WBRNAi00025286
• WBRNAi00070436
• WBRNAi00008707
• WBRNAi00070435
• WBRNAi00065797
• WBRNAi00065798
• WBRNAi00070437
• WBRNAi00031511
• WBRNAi00007985
• WBRNAi00045782
• WBRNAi00082388

44 Allele

• gk963801
• gk963053
• gk964349
• h13180
• h12564
• gk143913
• gk143912
• gk143915
• gk143914
• gk143909
• gk143911
• gk143910
• WBVar01666131
• gk962454
• WBVar01306574
• WBVar00224000
• WBVar01306573
• gk676836
• gk676837
• gk657244
• WBVar01960022
• iam1
• gk665438
• gk444019
• gk929767
• gk667543
• gk857905
• WBVar00172373
• gk477811
• gk815933

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00017895
• Start: 5921967
• End: 5924838
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_5924839..5927175
• Length (nt): 2337
• Chromosome Location: II: 5924839-5927175
• Organism: Caenorhabditis elegans

142 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly decreased expression in hsp-6(mg585) comparing to in N2 at L4 larva stage.	EdgeR, fold change > 2, FDR < 0.001.	WBPaper00056290:hsp-6(mg585)_downregulated
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
	Significantly differentially expressed genes as determined by microarray analysis of wild-type and cde-1 mutant germlines.	RNAs that changed at least 2-fold with a probability of p < 0.05 were considered differentially regulated between wildtype and cde-1.	WBPaper00035269:cde-1_regulated
Heat Shock: 35C 4 hours at L4 larva stage.	Transcripts that showed significantly decreased expression after L4 larva N2 animals were heat stressed at 35C for 4 hours	DESeq2	WBPaper00057154:HeatShock_downregulated_mRNA
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Genes down regulated by mir-243(n4759).	RNAs that changed at least 2-fold with a probability of p > 0.05 in three biological replicates were considered differentially regulated between wild-type and mir-243.	WBPaper00036130:mir-243_down_regulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
25C vs. 20C	Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:25C_vs_20C_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage.	DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05.	WBPaper00066110:tetraploid_vs_diploid_downregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:excretory-cell_L2-larva_expressed
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Proteins interacting with HA-PPM-1.D.	N.A.	WBPaper00062498:PPM-1.D_interacting
Bacteria: B.thuringiensis	Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407.	Cuffdiff	WBPaper00060358:B.thuringiensis_pathogen_regulated_elt-2(RNAi)

13 Expression Patterns

• Primary Identifier: Expr5892
• Remark: Strain: BC15649
• Reporter Gene: [tag-223::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCGTTTCATAGTTGTTATTCTTT] 3' and primer B 5' [GGGATTCTACCTGAAAATGAAATG] 3'.
• Pattern: Adult Expression: Reproductive System; vulva other; Larval Expression: intestine; rectal gland cells; Reproductive System; developing vulva; hypodermis; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr8783
• Remark: Picture: Fig 3, Fig S2.
• Pattern: Nuclear expression of VRK-1::GFP was observed in neurons and hypodermal cells in the head, VNC and tail of C. elegans larvae. Strong expression was also detected in all VPCs. At the L3 larval stage expression was highest in the primary fated vulva cell P6.p and its descendants. At L4 stage, VRK-1::GFP was expressed at equal levels in all 22 nuclei. One of the two transgenic strains showed additional but very weak VRK-1::GFP expression in some uterine cells. Expression was never observed in the AC with any of the two strains.
• Subcellular Localization: During division of VPCs, VRK-1::GFP was nuclear during interphase but relocated to the nuclear periphery immediately before cell division. During mitosis the protein was bound to chromatin.

• Primary Identifier: Expr15220
• Pattern: The VRK-1::GFP was predominantly localized to the nuclei of many cells, including neural, intestinal, and hypodermal cells. In addition, we found that VRK-1::GFP was highly expressed throughout the C. elegans life cycle, in the soma of larvae and fully grown adult worms, comprising postmitotic cells after the cells stopped dividing.

• Primary Identifier: Expr8292
• Remark: Picture: Figure 4G to 4H.
• Pattern: Expressed in head neurons, spermatheca, gut, pharynx, vulva, phasmids.

• Primary Identifier: Expr2036176
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr12707
• Pattern: The single-copy transgene was expressed at much lower levels and in a more ubiquitous manner than previously described (Klerkx et al., 2009). Nuclear expression was observed, not only in previously reported cells (Expr8783), but also in the anchor cell (AC), uterine tissue and germ line.
• Subcellular Localization: VRK-1 accumulates at the nuclear envelope at prophase and is associated with chromosomes in anaphase.

• Primary Identifier: Expr9079
• Remark: Picture: Fig. 8B.
• Subcellular Localization: VRK-1 is largely nuclear, based on co-localization with H2B:mCherry, throughout most of the cell cycle. On occasion it appears concentrated at chromatin-associated foci at the nuclear periphery during interphase. Additionally, VRK-1 was observed localized to structures resembling the nuclear envelope in cells that by DNA morphology appear to be in early prophase. Overall, VRK-1 localization in germ cells displays similar patterns of cell cycle-associated localization as described for early embryos.

• Primary Identifier: Expr9078
• Remark: Picture: Fig. 8A.
• Subcellular Localization: VRK-1 was detectable in the nuclei of germ cells at all stages of progression from the mitotic zone to mature oocytes, except in maturing spermatids.

• Primary Identifier: Chronogram502
• Remark: Original chronogram file: chronogram.1516.xml
• Reporter Gene: [F28B12.3:gfp] transcriptional fusion.

• Primary Identifier: Expr1037693
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1022864
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2018039
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1149696
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

32 GO Annotation

13 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00017895
• Start: 5921967
• End: 5924838
• Strand: 1

32 Ontology Annotations

2 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in isp-1(qm150);vrk-1(RNAi) comparing to in isp-1(qm150) animals.	EdgeR, FC < 0.5 or FC > 2.0, p<0.001.	WBPaper00060273:vrk-1(RNAi)_downregulated
	Transcripts that showed significantly increased expression in isp-1(qm150);vrk-1(RNAi) comparing to in isp-1(qm150) animals.	EdgeR, FC < 0.5 or FC > 2.0, p<0.001.	WBPaper00060273:vrk-1(RNAi)_upregulated

1 Sequence

• Length: 2872

1 Sequence Ontology Term

• Name: gene

3 Strains

• WBStrain00035995
• WBStrain00003839
• WBStrain00003833

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrII_5921618..5921966
• Length (nt): 349
• Chromosome Location: II: 5921618-5921966
• Organism: Caenorhabditis elegans