WormMine: Gene WBGene00018160

• WormBase Gene ID: WBGene00018160
• Gene Name: odr-8
• Sequence Name: F38A5.1
• Brief Description: odr-8 encodes the C. elegans ortholog of Ufm1-specific protease 2 (UfSP2); ODR-8 activity is required cell-autonomously for localization of a subset of G protein-coupled receptors (GPCRs), including ODR-10, by a Ufm1-independent mechanism; in regulating receptor localization, ODR-8 appears to function at an early step in GPCR trafficking; consequently, odr-8 mutant animals display defects in odortaxis, aggregation behavior, and responses to oxygen; ODR-8 physically interacts with ODR-4 to form a complex at the endoplasmic reticulum membrane; odr-8 is expressed in twelve chemosensory neurons: the ten amphid neurons and two phasmid neurons; odr-8 expression overlaps that of odr-4.
• Organism: Caenorhabditis elegans
• Automated Description: Enables deUFMylase activity. Involved in several processes, including positive regulation of chemotaxis; protein localization to non-motile cilium; and response to ethanol. Located in protein-containing complex. Expressed in amphid neurons and phasmid neurons. Used to study early infantile epileptic encephalopathy. Human ortholog(s) of this gene implicated in Beukes hip dysplasia and developmental and epileptic encephalopathy 106. Is an ortholog of human UFSP2 (UFM1 specific peptidase 2).
• Biotype: SO:0001217
• Genetic Position: :±
• Length (nt): 2869

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00018160

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F38A5.1a.1	F38A5.1a.1	2018	IV: 6579836-6582704
Transcript:F38A5.1b.1	F38A5.1b.1	1928	IV: 6579840-6582618

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F38A5.1a	F38A5.1a	1770	IV: 6580040-6580190
CDS:F38A5.1b	F38A5.1b	1728	IV: 6580040-6580190

7 RNAi Result

• WBRNAi00046671
• WBRNAi00014523
• WBRNAi00031939
• WBRNAi00023223
• WBRNAi00023457
• WBRNAi00023735
• WBRNAi00024022

43 Allele

• gk964500
• gk963722
• gk963417
• gk963416
• gk946250
• gk461993
• gk715328
• gk578375
• gk766696
• gk898747
• gk907998
• gk358717
• gk427039
• gk597835
• gk560103
• gk566115
• gk934759
• gk792452
• gk711744
• gk448362
• h15948
• gk203978
• gk203977
• gk203980
• gk203979
• gk203982
• gk203981
• gk203984
• gk203983
• gk203986

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00018160
• Start: 6579836
• End: 6582704
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_6579403..6579835
• Length (nt): 433
• Chromosome Location: IV: 6579403-6579835
• Organism: Caenorhabditis elegans

99 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:AVE-neuron_L1-larva_expressed
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:excretory-cell_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 0hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:germline-precursors_blastula-embryo_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Proteins identified in extracellular vesicle.	N.A.	WBPaper00062669:extracellular-vesicle_protein
	Genes regulated by DAF-16, according to whole transcriptome profiling to compare genome-wide regulatory influences of DPY-21 and SET-4 to those of the key transcription factors controlling dauer arrest in eak-7;akt-1 animals, DAF-16 and DAF-12.	Authors identified genes differentially expressed between wild-type and eak-7;akt-1 double mutant animals [fold change >= 1.5 and false discovery rate (FDR) < 0.05]. Authors then compared the transcriptomes of eak-7;akt-1 double mutants to those of eak-7;akt-1 animals harboring mutations in dpy-21, set-4, daf-16, or daf-12, and identified genes that are differentially expressed in the opposite direction as in wild-type relative to eak-7;akt-1. Annotated gene expression data output from CuffDiff v2.2.1 was read into R version 3.2.1 for six comparisons: eak-7;akt-1 compared to (1) wild-type, (2) daf-16(mu86);eak-7;akt-1, (3) daf-12;eak-7;akt-1, (4) set-4(n4600);eak-7;akt-1, (5) set-4(dp268);eak-7;akt-1, and (6) dpy-21;eak-7;akt-1. Authors filtered genes by the following criteria: (1) status = OK for wild-type vs. eak-7;akt-1, (2) fold change (FC) >= 1.5 or FC <= 1/1.5 for wild-type vs. eak-7;akt-1 and (3) FDR < 0.05 for at least two separate comparisons.	WBPaper00050801:DAF-16_dauer_regulome
	Genes regulated by DPY-21, according to whole transcriptome profiling to compare genome-wide regulatory influences of DPY-21 and SET-4 to those of the key transcription factors controlling dauer arrest in eak-7;akt-1 animals, DAF-16 and DAF-12.	Authors identified genes differentially expressed between wild-type and eak-7;akt-1 double mutant animals [fold change >= 1.5 and false discovery rate (FDR) < 0.05]. Authors then compared the transcriptomes of eak-7;akt-1 double mutants to those of eak-7;akt-1 animals harboring mutations in dpy-21, set-4, daf-16, or daf-12, and identified genes that are differentially expressed in the opposite direction as in wild-type relative to eak-7;akt-1. Annotated gene expression data output from CuffDiff v2.2.1 was read into R version 3.2.1 for six comparisons: eak-7;akt-1 compared to (1) wild-type, (2) daf-16(mu86);eak-7;akt-1, (3) daf-12;eak-7;akt-1, (4) set-4(n4600);eak-7;akt-1, (5) set-4(dp268);eak-7;akt-1, and (6) dpy-21;eak-7;akt-1. Authors filtered genes by the following criteria: (1) status = OK for wild-type vs. eak-7;akt-1, (2) fold change (FC) >= 1.5 or FC <= 1/1.5 for wild-type vs. eak-7;akt-1 and (3) FDR < 0.05 for at least two separate comparisons.	WBPaper00050801:DPY-21_dauer_regulome
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_L1-larva_expressed
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated

9 Expression Patterns

• Primary Identifier: Expr5987
• Remark: Strain: BC14232
• Reporter Gene: [F38A5.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCAAAATCAAGGTCGCA] 3' and primer B 5' [TTCTTCTTCTCTTCCAATCACCTT] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; amphids; tail neurons; phasmids; Larval Expression: intestine; hypodermis; Nervous System; head neurons; amphids; tail neurons; phasmids

• Primary Identifier: Expr11652
• Pattern: mcherry-ODR-8 expression was observed in 10 head neurons, the amphid neurons ADL, ASI, ASH, ASJ, ASG, ADF, ASK, AWA, AWB, AWC, and in two tail neurons, the phasmid neurons PHA and PHB. These are all the cells previously reported to express odr-4. Expression was not detected in any additional neurons.

• Primary Identifier: Expr1150541
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr10620
• Pattern: Expressed in head neurons (possibly amphids).

• Primary Identifier: Expr1037823
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1011873
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2014612
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr11653
• Subcellular Localization: mCherry-ODR-8 showed some co-localization with ODR-4 on the endoplasmic reticulum, although diffuse staining consistent with cytoplasmic localization was also observed. ODR- 4 and ODR-8 form a physical complex at the ER membrane.

• Primary Identifier: Expr2032845
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

19 GO Annotation

5 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00018160
• Start: 6579836
• End: 6582704
• Strand: -1

19 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2869

1 Sequence Ontology Term

• Name: gene

2 Strains

• WBStrain00005224
• WBStrain00005225

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_6582705..6582738
• Length (nt): 34
• Chromosome Location: IV: 6582705-6582738
• Organism: Caenorhabditis elegans