WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00018569 Gene Name  F47F2.1
Sequence Name  ? F47F2.1 Organism  Caenorhabditis elegans
Automated Description  Predicted to enable ATP binding activity and protein kinase activity. Predicted to be involved in protein kinase A signaling. Located in cytoplasm. Is an ortholog of human PRKX (protein kinase cAMP-dependent X-linked catalytic subunit). Biotype  SO:0001217
Genetic Position  Length (nt)  ? 14779
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00018569

Genomics

9 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:F47F2.1c.2 F47F2.1c.2 1438   X: 3878533-3893309
Transcript:F47F2.1f.1 F47F2.1f.1 1131   X: 3878571-3893040
Transcript:F47F2.1c.1 F47F2.1c.1 1545   X: 3879762-3893309
Transcript:F47F2.1g.1 F47F2.1g.1 1194   X: 3879844-3893040
Transcript:F47F2.1b.1 F47F2.1b.1 1540   X: 3884190-3893311
Transcript:F47F2.1d.1 F47F2.1d.1 1128   X: 3888475-3893040
Transcript:F47F2.1c.3 F47F2.1c.3 1389   X: 3888484-3893310
Transcript:F47F2.1c.4 F47F2.1c.4 1377   X: 3888485-3893250
Transcript:F47F2.1e.1 F47F2.1e.1 1116   X: 3888487-3893040
 

Other

6 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:F47F2.1f F47F2.1f 1131   X: 3878571-3878585
CDS:F47F2.1g F47F2.1g 1194   X: 3879844-3879921
CDS:F47F2.1b F47F2.1b 1197   X: 3884262-3884342
CDS:F47F2.1c F47F2.1c 978   X: 3888674-3888743
CDS:F47F2.1d F47F2.1d 1128   X: 3888475-3888603
CDS:F47F2.1e F47F2.1e 1116   X: 3888487-3888603

5 RNAi Result

WormBase ID
WBRNAi00047667
WBRNAi00015199
WBRNAi00030286
WBRNAi00108308
WBRNAi00081091

221 Allele

Public Name
gk963725
gk964260
WBVar01926790
gk963632
tm11267
WBVar01758096
WBVar01758095
WBVar01758098
WBVar01758097
WBVar01601416
WBVar01601414
WBVar01601415
h6860
gk276868
h6861
WBVar00077297
WBVar00077298
WBVar00077299
WBVar00077302
WBVar00077301
WBVar00077300
WBVar01825100
WBVar01549447
gk951019
gk951020
gk951017
gk951018
h11141
h16038
h5854

1 Chromosome

WormBase ID Organism Length (nt)
X Caenorhabditis elegans 17718942  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00018569 3878533 3893311 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

0 Downstream Intergenic Region

135 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:A-class-motor-neurons_larva_enriched
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
  Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc). DESeq2, fold change >= 2, FDR <= 0.01. WBPaper00056826:SGP_biased
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_aging
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_developing
  Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_regulated_aging
  Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_regulated_developing
  Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Bacteria infection: Bacillus thuringiensis Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304. N.A. WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
  Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684) To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
  Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. DESeq2 version 1.22.2, p < 0.05 WBPaper00064716:paraquat_downregulated
  Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. DESeq2, fold change > 2, adjusted p-value < 0.01 WBPaper00058598:sin-3(tm1276)_downregulated
  Transcripts depleted in purified oocyte P bodies comparing to in the whole animal. DESeq2, FDR < 0.05, fold change > 2. WBPaper00065975:P-body_vs_WholeAnimal_depleted
  Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals. Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. WBPaper00061479:hda-1(ne4752)_upregulated
  Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain. RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis. WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:hypodermis_L3-L4-larva_expressed
  Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. WBPaper00062159:hda-2(ok1479)_upregulated
  Transcripts that showed significantly increased expression in npr-15(tm12539) comparing to in N2 at L4 larva stage. Fold change > 2, FDR < 0.05. WBPaper00066608:npr-15(tm12539)_upregulated
  Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa. DESeq2, FDR <0.05, fold change > 2. WBPaper00059664:srbc-48(ac23)_upregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Psora-Allantoin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Allantoin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Metformin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50uM Rifampicin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Rifampicin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin-Allantoin_downregulated

5 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr1151508 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2022082 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
  The Gateway destination vector (pDM#834) was constructed as follows: an 1,878 bp promoter region upstream of T05G5.1 was amplified from wild type (N2) genomic DNA using primers T05G5.1-Fo-Hind, TACTTAAGCTTTTCCTATCTCCG-3 and T05G5.1-Re-XmaI, TCCCCCGGGGCCTGAAGATAAGTGTGAA, and then inserted between the HindIII and XmaI sites of the GFP-encoding vector pPD95.75 (Fire LabVector Kit available at http://www.addgene.org/pgvec1?f=3Dc&cmd=3Dshowcol&colid=3D 1) to generate pDM#823. A second PCR fragment containing the attR sites and the ccdB gene from the pDEST24 destination vector (nucleotides 70=961777; Invitrogen) was amplified and cloned into p#DM823 between the MscI and KpnI cloning sites to generate pDM#834.This plasmid was transformed into the E. coli strain DB3.1 (Invitrogen), which is tolerant for the ccdB selectable marker gene. Entry clones were obtained from the ORFeome project (Open Biosystems) and cloned into the destination vector pDM#834 using the gateway strategy with LR clonase (Invitrogen) to make the pT05G5.1 ::ORF::GFP expression clones. Expr9570   Sub-cellular localization within the body wall muscle: Cytoplasm +/- Other
    Expr1023743 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2003859 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

15 GO Annotation

Annotation Extension Qualifier
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
part_of(WBbt:0006804) located_in
  involved_in
  involved_in
  involved_in
  involved_in
  enables

5 Homologues

Type
orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00018569 3878533 3893311 1

15 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
part_of(WBbt:0006804) located_in
  involved_in
  involved_in
  involved_in
  involved_in
  enables

0 Regulates Expr Cluster

1 Sequence

Length
14779

1 Sequence Ontology Term

Identifier Name Description
gene  

1 Strains

WormBase ID
WBStrain00037388

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrX_3876006..3878532   2527 X: 3876006-3878532 Caenorhabditis elegans