WormMine: Gene WBGene00020097

• WormBase Gene ID: WBGene00020097
• Gene Name: larp-1
• Sequence Name: R144.7
• Brief Description: larp-1 encodes an La-related protein containing an La RNA-binding motif and a conserved LARP1 domain; loss of larp-1 activity results in defective oogenesis, which is suppressed by loss of function mutations in Ras-MAPK signaling components, suggesting that in the germline, LARP-1 functions to negatively regulate Ras-MAPK pathway activity; as LARP-1 binds RNA homopolymers in vitro and larp-1 mutants show elevated mRNA and protein levels of select Ras-MAPK pathway components, LARP-1 likely affects oogenesis via regulation of Ras-MAPK signaling; in the germline, LARP-1 localizes to P bodies, cytoplasmic foci that function in mRNA degradation.
• Organism: Caenorhabditis elegans
• Automated Description: Enables poly(G) binding activity and poly(U) RNA binding activity. Predicted to be involved in positive regulation of translation. Located in P-body. Expressed in germ line; head; and tail. Is an ortholog of human LARP1 (La ribonucleoprotein 1, translational regulator) and LARP1B (La ribonucleoprotein 1B).
• Biotype: SO:0001217
• Genetic Position: III :-2.23723 ±0.011878
• Length (nt): 8726

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00020097

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:R144.7b.1	R144.7b.1	4633	III: 5008925-5017650
Transcript:R144.7a.1	R144.7a.1	3637	III: 5008925-5016524

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:R144.7a	R144.7a	2457	III: 5010105-5010131
CDS:R144.7b	R144.7b	3453	III: 5010105-5010131

19 RNAi Result

• WBRNAi00073800
• WBRNAi00073801
• WBRNAi00073798
• WBRNAi00051963
• WBRNAi00072603
• WBRNAi00073797
• WBRNAi00073796
• WBRNAi00087340
• WBRNAi00068819
• WBRNAi00087337
• WBRNAi00087341
• WBRNAi00034936
• WBRNAi00068775
• WBRNAi00073795
• WBRNAi00073799
• WBRNAi00002685
• WBRNAi00009076
• WBRNAi00026124
• WBRNAi00087336

133 Allele

• otn11053
• q783
• gk964504
• gk964503
• WBVar02067520
• WBVar01263323
• WBVar01263322
• WBVar01263324
• WBVar01263321
• WBVar01263327
• WBVar01263326
• WBVar01263329
• WBVar01656629
• WBVar01656628
• WBVar01656627
• WBVar01656630
• otn2946
• h15895
• h5138
• tm2110
• tm1985
• gk673340
• gk439364
• gk708205
• gk954303
• gk961757
• gk961497
• WBVar01408551
• WBVar01408552
• WBVar01408553

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00020097
• Start: 5008925
• End: 5017650
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_5008831..5008924
• Length (nt): 94
• Chromosome Location: III: 5008831-5008924
• Organism: Caenorhabditis elegans

119 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
Transgeneration hypoxia treatment.	Transcripts that are significantly upregulated in F1 animals after P0 parents were exposed to 0.1% oxygen for 16 hours at L4 larva stage.	For calling the significant differentially expressed genes (DEGs),the false discovery rate (FDR) after multiple testing correction was set as 0.05 and analyzed in edgeR.	WBPaper00064871:hypoxia_upregulated_F1
	Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage.	DESeq2, fold change > 2	WBPaper00058725:sftb-1(cer6)_downregulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
Temprature shift to 28C for 24 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_24h_downregulated
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_downregulated
	Proteins that showed significantly decreased expression in 1-day-old sek-1(km4) adults comparing to in wild type animals, both with 6 hours of cisplatin treatment.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:sek-1(km4)_downregulated_cisplatin
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Proteins interacting with HA-PPM-1.D.	N.A.	WBPaper00062498:PPM-1.D_interacting
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (FLT) starting at L1 lava stage.	DESeq	WBPaper00053302:alovudine_24h_regulated
	Transcripts that showed significantly increased expression in jmjd-3.1p::jmjd-3.1 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:jmjd-3.1(+)_upregulated
	Transcripts that showed significantly increased expression in rgef-1p::jmjd-1.2 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:rgef-1p-jmjd-1.2(+)_upregulated
	Transcripts that showed significantly increased expression in sur-5p::jmjd-1.2 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:sur-5p-jmjd-1.2(+)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (Young adult all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:CEP-sheath-cells_Day1-adult_expressed
	Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C.	N.A.	WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C

11 Expression Patterns

• Primary Identifier: Expr6542
• Remark: Strain: BC12810
• Reporter Gene: [larp-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGGATACGGTGAAGCAGCC] 3' and primer B 5' [CTTGCTGTTGATGTTAGCAAGTTT] 3'.
• Pattern: Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; spermatheca; body wall muscle; excretory cell; Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing gonad; body wall muscle; excretory cell

• Primary Identifier: Expr6543
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC12987
• Reporter Gene: [larp-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGGATACGGTGAAGCAGCC] 3' and primer B 5' [CTTGCTGTTGATGTTAGCAAGTTT] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; vulva other; spermatheca; body wall muscle; hypodermis; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; Reproductive System; developing vulva; body wall muscle; hypodermis; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr1019380
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr8133
• Remark: Picture: Figure 7, Figure S2.
• Subcellular Localization: CAR-1 is an Scd6 homolog that reside in a variety of RNA regulatory particles, including P bodies, P granules, Drosophila neuronal granules, and mammalian stress granules. In C. elegans, primarily two types of CAR-1 foci exist: those with P body proteins, such as DCAP-1, and those with P granule protein PGL-1. Significant overlap of LARP-1 and CAR-1 were observed in the mid-pachytene region. Since LARP-1 is excluded from P granules (see Expr8132, authors reasoned that the LARP-1/CAR-1 foci were P bodies. Moreover, as with DCAP-1 and LARP-1 colocalization, only a subset of CAR-1 and LARP-1 foci colocalized. These results confirm that LARP-1 accumulates in a subset of germline P bodies. Wild-type and larp-1(0) germ lines were costained with aLARP-1 and a polyclonal antibody directed against DCAP-1. DCAP-1 was predominately cytoplasmic and accumulated in irregularly shaped puncta. DCAP-1 was most abundant in the mitotic region, mid- pachytene region, and distal oocytes and least abundant in the transition zone, early pachytene region, and most proximal oocytes. LARP-1 and DCAP-1 overlapped throughout the distal germ line and colocalized in perinuclear foc. However, not all DCAP-1 foci stained positively for aLARP-1 and not all LARP-1 foci were positive for aDCAP-1. These results indicate that LARP-1/DCAP-1 foci define a unique subset of P bodies in the germ line.

• Primary Identifier: Expr8132
• Remark: Picture: Figure 6.
• Subcellular Localization: LARP-1 expression extended throughout the germ line - from the distal tip into developing oocytes, with a pronounced decline in the most proximal oocytes. Moreover, LARP-1 was primarily cytoplasmic and concentrated in discrete, irregular-shaped puncta around nuclei. LARP-1 puncta were missing in larp-1(0) germ lines, confirming specificity of the LARP-1 antibody, and were not detected in the rachis. Co-stainiing of anti-LARP-1 and anti-P granule indicated no overlap. Thus LARP-1 is predominately cytoplasmic and enriched in discrete puncta that do not contain PGL-1.

• Primary Identifier: Expr1038736
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1155607
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2013012
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2031244
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1004
• Remark: Original chronogram file: chronogram.2062.xml
• Reporter Gene: [R144.7:gfp] transcriptional fusion.

• Primary Identifier: Chronogram1095
• Remark: Original chronogram file: chronogram.216.xml
• Reporter Gene: [R144.7:gfp] transcriptional fusion.

14 GO Annotation

8 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00020097
• Start: 5008925
• End: 5017650
• Strand: -1

14 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 8726

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00022637
• WBStrain00022648
• WBStrain00002339
• WBStrain00002435

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_5017651..5018638
• Length (nt): 988
• Chromosome Location: III: 5017651-5018638
• Organism: Caenorhabditis elegans