WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00020496 Gene Name  spat-3
Sequence Name  ? T13H2.5 Brief Description  spat-3 encodes, by transcription from alternative promoters, two large(1092- and 2471-residues) proteins; while residues 162-228 of the largerSPAT-3 protein encode a Ring1 type of zinc-finger domain (like that seenin SEX COMBS EXTRA, an E3 ubiquitin-protein ligase RING1 protein ofDrosophila melanogaster), the bulk of SPAT-3 has no obvious similaritiesto other proteins; consistent with its predicted role as a PRC1 component, spat-3 activity is required in vivo for histone H2A ubiquitination; spat-3 is also required for proper positioning of Ray 1 in the male tail, neuronal migration and axon extension, vulval development, and fully wild-type brood sizes; SPAT-3 is also specifically required for PAR protein-dependent cell-polarity, and this requirement is independent ofPAR-2 activity; as with par-3, par-6, pkc-3, and cdc-42, inactivation ofspat-3 (by RNAi or mutation) strongly suppresses the embryonic lethalityof par-2(it5ts) at restrictive temperature; as with nos-3, spat-3 alsosuppresses par-2(lw32), a strong loss-of-function allele; while spat-3par-2 double mutant embryos require PAR-1 for viability, PAR-1 does notregain posterior cortical localization in these embryos, but is insteaddiffused through their cytoplasm.
Organism  Caenorhabditis elegans Automated Description  Enables histone ubiquitin ligase activity. Involved in several processes, including negative regulation of gene expression, epigenetic; negative regulation of vulval development; and nematode male tail tip morphogenesis. Predicted to be part of PcG protein complex and ubiquitin ligase complex. Expressed in several structures, including AIYL; AIYR; SMDDL; and SMDDR. Used to study developmental disorder of mental health. Human ortholog(s) of this gene implicated in Luo-Schoch-Yamamoto syndrome and pancreatic ductal carcinoma. Is an ortholog of human RING1 (ring finger protein 1) and RNF2 (ring finger protein 2).
Biotype  SO:0001217 Genetic Position  X :-7.1921 ±0.004336
Length (nt)  ? 9918
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00020496

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:T13H2.5a.1 T13H2.5a.1 7651   X: 4596011-4605928
Transcript:T13H2.5b.1 T13H2.5b.1 3279   X: 4596199-4599989
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:T13H2.5a T13H2.5a 7431   X: 4596199-4596384
CDS:T13H2.5b T13H2.5b 3279   X: 4596199-4596384

7 RNAi Result

WormBase ID
WBRNAi00053292
WBRNAi00053294
WBRNAi00018696
WBRNAi00076677
WBRNAi00065860
WBRNAi00077114
WBRNAi00063638

166 Allele

Public Name
gk964260
gk962667
WBVar02063511
WBVar01601610
WBVar01601611
WBVar01601614
WBVar01601615
WBVar01601612
WBVar01601613
WBVar00078061
WBVar00078063
WBVar00078062
WBVar01710627
WBVar01710628
WBVar01549460
gk954124
gk953474
h9290
otn19088
gk22
tm4179
WBVar01878124
WBVar01878125
WBVar01878128
WBVar01878129
WBVar01878126
WBVar01878127
WBVar01878131
WBVar01878132
WBVar01878130

1 Chromosome

WormBase ID Organism Length (nt)
X Caenorhabditis elegans 17718942  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00020496 4596011 4605928 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrX_4592351..4596010   3660 X: 4592351-4596010 Caenorhabditis elegans

162 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Genes with expression altered >= 3-fold in dpy-10(e128) mutants. Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). WBPaper00035873:dpy-10_regulated
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:bodywall-muscle_L1-larva_expressed
  Genome-wide analysis of developmental and sex-regulated gene expression profile. self-organizing map cgc4489_group_18
  Transcripts that showed altered expression in cat-1(RNAi) animals comparing to control animals injected with empty vector. p-value <= 0.05 WBPaper00066902:cat-1(RNAi)_regulated
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_developing
  Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_regulated_developing
Bacteria diet: Escherichia coli HB101. Fed for 30 generations. Transcripts that showed significantly decreased expression after fed by bacteria E. coli HB101 for 30 generations comparing to animals fed by E. coli OP50. DESeq2 fold change > 2, p-value < 0.01. WBPaper00061007:HB101_downregulated
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations. Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50. DESeq2 fold change > 2, p-value < 0.01. WBPaper00061007:S.aquatilis_downregulated
  Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. All three experiments have CPM >= 1. WBPaper00067147:germline_expressed
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
  Transcripts that showed significantly decreased expression in skn-1gf(lax188) comparing to in N2 animals at L4 stage fed with OP50 and exposed to PA14 for 4 hours. DESeq2, FDR < 0.05, fold change > 2. WBPaper00067255:skn-1(lax188)_downregulated_PA
  Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage. DESeq2(v1.32.0), FDR < 0.05. WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
  Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation). CuffDiff2 WBPaper00051265:F4_hrde-1(tm1200)_upregulated
  Transcripts that showed significantly increased expression in enriched nuclei of daf-2(e1370) comparing to in wild type nuclei. edgeR, fold change > 2, FDR < 0.05 WBPaper00067267:daf-2(e1370)_upregulated_nuclei
  Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure. Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2). DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:S.aureus-4h_upregulated_N2
Bacteria infection: Staphylococcus aureus Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals not colonized by microbiota and not infected by pathogen. DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05. WBPaper00067479:Microbiota-Pathogen_vs_control_downregulated
Bacteria infection: Staphylococcus aureus Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals colonized by microbiota but not infected by pathogen. DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05. WBPaper00067479:Microbiota-Pathogen_vs_Microbiota_downregulated
  Transcripts that showed significantly increased expression after exposure to 75uM paraquat(PQ) from L1 to day 2 adult stage in skn-1(lax188) animals fold change > 2 WBPaper00058711:paraquat_upregulated
25C vs. 20C Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C. CuffDiff, fold change > 2. WBPaper00065096:25C_vs_20C_upregulated
  Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C. CuffDiff, fold change > 2. WBPaper00065096:Day10_vs_Day1_upregulated

8 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2034254 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Also expressed in (comments from author) : No comments. Strain: BC14944 [T13H2.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTGGAAGCCGTTGAAGC] 3' and primer B 5' [CCTTGTAGTTTTCCGATTCCTTTA] 3'. Expr6691 Adult Expression: Nervous System; head neurons; amphids; Larval Expression: Nervous System; head neurons; amphids;  
    Expr16285 MIG-32 and SPAT-3 are broadly expressed in many cells of the embryo, larvae and adults. We observed expression of MIG-32 and SPAT-3 in the SMDD/AIY mother cell before its terminal division. Following division, MIG-32 and SPAT-3 are detected in the postmitotic SMDD and AIY with similar levels between daughter cells. MIG-32 and SPAT-3 then remain expressed in the AIY neurons throughout embryogenesis, larval and adult stages.  
    Expr16284   MIG-32 and SPAT-3 are enriched in the nucleus, as expected for chromatin factors.
    Expr1038934 Tiling arrays expression graphs  
    Expr2016019 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1156880 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1017346 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

14 GO Annotation

Annotation Extension Qualifier
  enables
  enables
  enables
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  part_of
  part_of
  part_of

8 Homologues

Type
least diverged orthologue
least diverged orthologue
least diverged orthologue
orthologue
orthologue
orthologue
orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00020496 4596011 4605928 -1

14 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables
  enables
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  part_of
  part_of
  part_of

0 Regulates Expr Cluster

1 Sequence

Length
9918

1 Sequence Ontology Term

Identifier Name Description
gene  

4 Strains

WormBase ID
WBStrain00033902
WBStrain00033901
WBStrain00035491
WBStrain00003307

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrX_4605929..4606506   578 X: 4605929-4606506 Caenorhabditis elegans