WormMine: Gene WBGene00000272

• WormBase Gene ID: WBGene00000272
• Gene Name: bro-1
• Sequence Name: F56A3.5
• Brief Description: bro-1 encodes an ortholog of human CBFB (OMIM:121360, mutated in acute myeloid leukemia and CBFB haploinsufficiency) and Drosophila BRO/BGB; BRO-1 is required for the normal proliferation and differentiation of seam cells, alae, and male tail rays; bro-1 mutants exhibit defective seam cell division and differentiation, and males exhibit ray loss; conversely, transgenic overexpression of BRO-1 induces excess seam cell divisions at least somewhat independently of RNT-1; coexpression of both BRO-1 and RNT-1 induces full seam cell hyperplasia; rnt-1 transcription is abnormally high in bro-1 mutant larvae; BRO-1 is also required for normal structural integrity of the vulva, with bro-1 mutants showing ruptured vulvae; BRO-1 is expressed in both cytoplasm and nuclei of hypodermal seam cells (from bean-stage embryos onward), muscle cells, the uterine seam (utse) cell in late L4 larvae, some pharyngeal neurons, and male ray precursor cells, and transgenic expression of BRO-1 in seam cells alone rescues the bro-1(bp133) mutation; seam cell phenotypes of bro-1 mutants are partly suppressed by inactivation of LIN-35, FZR-1, and CKI-1, all of which inhibit progression from G1 to S phase of the cell cycle; the structural similarity of BRO-1 to CBFbeta has been confirmed by circular dichroism; BRO-1 is bound in vitro by the RUNT domains (RDs) of either RNT-1 or its human ortholog RUNX1; although BRO-1 does not itself bind DNA, it does bind to a complex of DNA with RNT-1's RD, and enhances both the strength and the specificity of RNT-1's DNA binding when it does so; BRO-1 is genetically redundant with UNC-37 and SOP-1 in specifying seam cell fate, and BRO-1's ligand RNT-1 binds UNC-37 in vitro; bro-1(bp133) and sop-1(RNAi) also show synthetic lethality.
• Organism: Caenorhabditis elegans
• Automated Description: Enables transcription corepressor activity. Involved in several processes, including negative regulation of transcription by RNA polymerase II; nematode male tail tip morphogenesis; and positive regulation of locomotion involved in locomotory behavior. Located in nucleus. Part of core-binding activity factor complex. Expressed in hypodermis; muscle cell; pharyngeal neurons; ray precursor cell; and uterine seam cell. Human ortholog(s) of this gene implicated in acute myelomonocytic leukemia and hepatocellular carcinoma. Is an ortholog of human CBFB (core-binding factor subunit beta).
• Biotype: SO:0001217
• Genetic Position: I :-0.301369 ±0.003667
• Length (nt): 2315

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00000272

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F56A3.5.1	F56A3.5.1	1142	I: 5186926-5189240

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F56A3.5	F56A3.5	459	I: 5186985-5187149

1 RNAi Result

• WBRNAi00048587

29 Allele

• gk962706
• gk963902
• tm658
• gk822026
• gk502534
• gk857280
• gk703764
• gk342734
• gk801164
• gk565567
• gk584880
• gk792178
• gk682450
• gk648013
• gk351760
• gk824124
• gk706354
• gk928093
• gk422056
• h17528
• h9342
• WBVar01911739
• bp133
• WBVar00153491
• tm1183
• gk110696
• gk110697
• gk960651
• tm1229

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00000272
• Start: 5186926
• End: 5189240
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_5189241..5190137
• Length (nt): 897
• Chromosome Location: I: 5189241-5190137
• Organism: Caenorhabditis elegans

123 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts that showed significantly increased expression in animal with pgph-2 overepxreesion [pgph-2p-pgph-2; myo-2p-mcherry] in glucose excess condition.	Genes with anadjusted P-value <= 0.05 found by DESeq2 were assigned as differentially expressed.	WBPaper00065926:pgph-2(overepxreesion)_upregulated_glucose
	Transcripts that showed differential expression between 24 and 26 hours post hatching L2d and dauer committed larvae of daf-9(dh6), triggered by the dafachronic acid (DA) growth hormone. Cluster 3 genes increased expression transiently at 26 hour post hatching.	Benjamini Hochberg corrected q-value < 0.01.	WBPaper00053388:dauer_regulated_Cluster3
	Genes that showed oscillating mRNA expression level throughout the 16 hour time courses from L3 larva to young adult.	The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak.	WBPaper00044736:oscillating_dev_expression
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_L2-larva_expressed
	Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2.	DESeq 2, fold change > 2, FDR < 0.05.	WBPaper00065581:hpk-1(pk1393)_upregulated
	Transcripts that showed significantly increased expression in pie-1(ne4443[PIE-1-Degron-GFP])	DESeq2. Differentially expressed genes were defined as twofold change and adjusted p-value less than 0.05.	WBPaper00061478:pie-1(ne4433)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_downregulated
Bacteria: B.thuringiensis	Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407.	Cuffdiff	WBPaper00060358:B.thuringiensis_pathogen_regulated_elt-2(RNAi)
Bacteria: B.thuringiensis	Transcripts in N2 animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407.	Cuffdiff	WBPaper00060358:B.thuringiensis_pathogen_regulated_N2

11 Expression Patterns

• Primary Identifier: Expr4836
• Remark: Picture: Figs. 4A-D.
• Pattern: In hermaphrodites, the expression of bro-1 was restricted to seam cells. Its expression was first detected at bean-stage embryos and persisted throughout the developmental stages. In the male tail, bro-1 was also expressed in the ray precursor cells.
• Subcellular Localization: GFP::BRO-1 was localized to both the cytoplasm and the nucleus.

• Primary Identifier: Expr4980
• Remark: Picture: Fig 4B. Similar expression patterns were observed for a variety of different transgenic alleles, carrying both extrachromosomal and integrated arrays.
• Pattern: In all larval stages, BRO-1::GFP is expressed in H0 to 2, V1 to 6 and T seam progeny. Faint expression is also observed in hypodermal nuclei, some of which are embryonically derived and which are not therefore simply anterior daughters of the L1 stem cell division containing a perdurance of GFP expression. Expression of BRO-1::GFP was also seen in the uterine seam (utse) during late L4 in hermaphrodites.
• Subcellular Localization: BRO-1::GFP is localised to both the cytoplasm and nucleus.

• Primary Identifier: Expr4981
• Remark: Picture: Fig. 4D, 4E.
• Pattern: BRO-1 and RNT-1 are co-expressed in seam and muscle cells, and BRO-1 is additionally expressed in hypodermal nuclei, certain pharyngeal neurons and the utse.
• Subcellular Localization: Co-localisation is shown using rescuing bro-1::DsRed (pAW303) and rnt-1::GFP (pAW260) constructs. Faint BRO-1::RFP and RNT-1::GFP co-localisation is also observed in certain body wall muscle cells. BRO-1::RFP, but not RNT-1::GFP, was observed in certain pharyngeal neurons.

• Primary Identifier: Expr4901
• Remark: Data came from J Shim and J Lee (submitted), cannot locate original publication.
• Pattern: bro-1 is expressed only in the hypodermal seam cells. It is expressed throughout development.
• Subcellular Localization: The nematode bro-1 is mostly localized in the cytoplasm but is also present in the nucleus.

• Primary Identifier: Expr2009658
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6210
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15605
• Reporter Gene: [bro-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGATTCGAATAAAAATGGTTTAC] 3' and primer B 5' [TGAGAATATTCACCAAGTGGAAGA] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine

• Primary Identifier: Expr1030176
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr7887
• Remark: Picture: Figure 1. Reporter gene fusion type not specified.
• Pattern: bro-1 was strongly expressed throughout development from the late embryonic stage.

• Primary Identifier: Expr1152371
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2027897
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1026156
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

19 GO Annotation

5 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00000272
• Start: 5186926
• End: 5189240
• Strand: 1

19 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2315

1 Sequence Ontology Term