WormMine: Gene WBGene00001403

• WormBase Gene ID: WBGene00001403
• Gene Name: fbl-1
• Sequence Name: F56H11.1
• Brief Description: fbl-1 encodes proteins orthologous to the vertebrate basement membrane protein fibulin; fbl-1 activity is essential for gonad and body morphology, as well as for reproduction; fbl-1 interacts genetically with gon-1 and mig-17, which encode ADAMTS metalloproteases essential for gonad development; the FBL-1C isoform is expressed in anterior and posterior intestinal cells and localizes to the gonad and pharyngeal basement membranes; the FBL-1D isoform is expressed in some head and tail body wall muscle cells.
• Organism: Caenorhabditis elegans
• Automated Description: An extracellular matrix structural constituent. Involved in extracellular matrix organization; positive regulation of locomotion; and protein localization. Located in basement membrane. Expressed in ALM; GLR; basal lamina; hyp7 syncytium; and nerve ring. Is an ortholog of human FBLN1 (fibulin 1).
• Biotype: SO:0001217
• Genetic Position: IV :4.30419 ±0.002555
• Length (nt): 5447

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001403

Genomics

8 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F56H11.1c.1	F56H11.1c.1	2390	IV: 9540806-9546252
Transcript:F56H11.1a.1	F56H11.1a.1	2288	IV: 9540808-9545216
Transcript:F56H11.1g.1	F56H11.1g.1	2432	IV: 9540808-9545243
Transcript:F56H11.1b.1	F56H11.1b.1	2242	IV: 9540835-9546250
Transcript:F56H11.1d.1	F56H11.1d.1	1887	IV: 9540852-9545111
Transcript:F56H11.1h.1	F56H11.1h.1	2004	IV: 9540852-9545111
Transcript:F56H11.1e.1	F56H11.1e.1	1935	IV: 9540852-9546095
Transcript:F56H11.1f.1	F56H11.1f.1	1818	IV: 9540852-9546095

Other

8 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F56H11.1d	F56H11.1d	1887	IV: 9540852-9540891
CDS:F56H11.1e	F56H11.1e	1935	IV: 9540852-9540891
CDS:F56H11.1a	F56H11.1a	2139	IV: 9540852-9540891
CDS:F56H11.1b	F56H11.1b	2070	IV: 9540852-9540891
CDS:F56H11.1c	F56H11.1c	2187	IV: 9540852-9540891
CDS:F56H11.1f	F56H11.1f	1818	IV: 9540852-9540891
CDS:F56H11.1g	F56H11.1g	2256	IV: 9540852-9540891
CDS:F56H11.1h	F56H11.1h	2004	IV: 9540852-9540891

9 RNAi Result

• WBRNAi00048771
• WBRNAi00048772
• WBRNAi00048773
• WBRNAi00062661
• WBRNAi00116170
• WBRNAi00015848
• WBRNAi00018168
• WBRNAi00027780
• WBRNAi00110311

63 Allele

• gk964278
• gk964078
• gk964500
• gk962765
• q750
• q771
• WBVar02121028
• tk51
• tk45
• gk946497
• WBVar01855965
• ttTi54271
• gk462025
• gk209113
• gk726852
• gk209114
• gk401714
• gk476607
• gk407719
• gk464165
• tm1253
• gk666608
• gk551129
• gk209121
• gk706526
• gk209122
• gk903673
• gk911849
• gk209119
• gk826483

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001403
• Start: 9540806
• End: 9546252
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_9546253..9546285
• Length (nt): 33
• Chromosome Location: IV: 9546253-9546285
• Organism: Caenorhabditis elegans

207 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_aging
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly decreased expression in hsp-6(mg585) comparing to in N2 at L4 larva stage.	EdgeR, fold change > 2, FDR < 0.001.	WBPaper00056290:hsp-6(mg585)_downregulated
	Transcripts that showed significantly decreased expression in mdt-15(mg584gf) comparing to in N2 at L4 larva stage.	EdgeR, fold change > 2, FDR < 0.001.	WBPaper00056290:mdt-15(mg584)_downregulated
	Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2.	DESeq2, Fold change > 1.5.	WBPaper00051404:alg-1(gk214)_upregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage.	DESeq2, fold change > 2	WBPaper00058725:sftb-1(cer6)_downregulated
	Transcripts that showed significantly decreased expression in dissected female germline comparing to in dissected male germline.	Log2 Fold change > 2 or <-1, p-value < 0.05.	WBPaper00053599:female_vs_male_downregulated
	Genes that showed increased expression after nicotic acid (NA) treatment.	Raw counts for the genes were analyzed using the R Statistical Computing Environment and the Bioconductor packages DESeq and edgeR. Both packages provide statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochberg's approach for controlling the false discovery rate (FDR). If both FDR values (by DESeq and edgeR) were smaller than p = 0.05, genes were assigned as differentially expressed.	WBPaper00044260:nicotinc-acid_upregulated
	Transcripts that showed significantly increased expression in xrep-4(lax137).	DESeq2. Genes were selected if their p value < 0.01.	WBPaper00066062:xrep-4(lax137)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:Cisplatin_downregulated_WT
	Genes that showed oscillating mRNA expression level throughout the 16 hour time courses from L3 larva to young adult.	The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak.	WBPaper00044736:oscillating_dev_expression
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Transcripts that showed significantly increased expression in mep-1(ne4629[MEP-1-GFP-Degron]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:mep-1(ne4629)_upregulated

13 Expression Patterns

• Primary Identifier: Expr4320
• Subcellular Localization: Full-length VENUS::FBL-1C localizes to pharyngeal and gonadal basal laminas. Transgenes containing either EGF2C or FIBC were localized to both pharyngeal and gonadal basal laminae. In contrast, VENUS::FBL-1D did not localize to either basal lamina.

• Primary Identifier: Expr1030840
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr6234
• Remark: Strain: BC14720
• Reporter Gene: [fbl-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGTCGCTGATTGTGTGATAACTGT] 3' and primer B 5' [TCTACTAAAATTTCCACGGGGTT] 3'.
• Pattern: Adult Expression: intestine; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; body wall muscle; Nervous System; head neurons; tail neurons; Larval Expression: intestine; anal depressor muscle; body wall muscle; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr3679
• Pattern: Expression was most dramatic in the anterior and posterior two to four intestinal cells, head and tail body-wall muscles, and in the hypodermal syncytium. Intestinal expression is detected in late embryogenesis and gradually decreases in anterior intestinal cells until it is not detectable in adults, but it persists in the posterior intestinal cells well into adulthood. Hypodermal, and head and tail body-wall muscle, expression is also detected late in embryogenesis and persists into adulthood. In the hermaphrodite gonad, expression is seen in the spermatheca, starting in young adult hermaphrodites and remaining strong in older adults. Rare expression is also detected in three to five unidentified neurons in the nerve ring.

• Primary Identifier: Expr3156
• Pattern: Both reporters expressed GFP in head muscle cells, anterior intestinal cells, posterior intestinal cells, and tail muscle cells. The GFP::FBL-1 fusion protein accumulated around the pharynx, apparently in its basal lamina, and in the intestinal cytoplasm. The pharyngeal accumulation was not dependent on gon-1 activity because GFP::FBL-1 fusion protein was detected around the pharynx in gon-1(0) mutants.

• Primary Identifier: Expr3210
• Pattern: GFP was strongly expressed at the anterior and posterior ends of intestinal cells as well as in some of the body wall muscle cells in the head, tail, and dorsal side. These expression patterns were especially evident in late embryos and early larvae. The expression in the intestinal cells gradually expanded to the central region during the later larval stages.

• Primary Identifier: Expr3211
• Remark: Both fbl-1C::Venus and fbl-1D::Venus constructs rescued fbl-1(tk45) mutants, suggesting that Venus fusion proteins are functional.
• Pattern: FBL-1C-Venus was expressed at the anterior and posterior ends of intestinal cells and localized to the gonadal and pharyngeal basement membranes. FBL-1D-Venus was strongly expressed in some of the body wall muscle cells in the head and tail. However, the FBL-1D-Venus was not detected in basement membranes.
• Subcellular Localization: FBL-1C-Venus was expressed at the gonadal and pharyngeal basement membranes. FBL-1D-Venus was was not detected in basement membranes.

• Primary Identifier: Expr2011445
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1152522
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram2082
• Remark: Original chronogram file: chronogram.997.xml
• Reporter Gene: [F56H11.1:gfp] transcriptional fusion.

• Primary Identifier: Expr2029683
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1025268
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr12566
• Pattern: Not detected in ALML nor PLML.

11 GO Annotation

4 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001403
• Start: 9540806
• End: 9546252
• Strand: 1

11 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 5447

1 Sequence Ontology Term