Genomics
2 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:F10C1.2b.1 | F10C1.2b.1 |
2187
 |
II: 5765618-5772084 |
| Transcript:F10C1.2a.1 | F10C1.2a.1 |
2072
|
II: 5768945-5772070 |
Other
2 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:F10C1.2b | F10C1.2b |
1770
|
II: 5765642-5765774 |
| CDS:F10C1.2a | F10C1.2a |
1677
|
II: 5768961-5769000 |
26 RNAi Result
100 Allele
| Public Name |
|---|
| gk963801 |
| gk963053 |
| gk964349 |
| gk678399 |
| ju71 |
| WBVar01695526 |
| WBVar01603922 |
| tm10763 |
| WBVar01437938 |
| WBVar01437939 |
| WBVar01437942 |
| WBVar01373366 |
| WBVar01719931 |
| WBVar01719930 |
| WBVar01783513 |
| WBVar01413464 |
| WBVar01982474 |
| WBVar00234537 |
| gk695295 |
| gk649584 |
| gk659688 |
| gk411197 |
| gk1411 |
| gk609566 |
| gk542246 |
| gk926291 |
| gk478834 |
| gk407607 |
| gk867859 |
| gk511606 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00002053 | 5765618 | 5772084 | 1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
234 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| oocyte proteins identified by two or more unique peptides during proteomics study. | In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. | WBPaper00038289:oocyte_protein | |
| Genes with expression altered >= 3-fold in dpy-10(e128) mutants. | Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). | WBPaper00035873:dpy-10_regulated | |
| Transcripts of coding genes that showed significantly decreased expression in muscle. | DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. | WBPaper00062325:muscle_depleted_coding-RNA | |
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. | SAM | WBPaper00031040:TGF-beta_adult_upregulated | |
| Genes that were downregulated in lin-15B(n744). | For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis. | WBPaper00038168:lin-15B(n744)_downregulated | |
| Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. | N.A. | WBPaper00064071:NHR-49_interacting | |
| Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:arcade_intestinal-valve_expressed | |
| Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
| Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. | DESeq2, fold change > 2, FDR < 0.05 | WBPaper00065835:Day5_vs_Day1_downregulated | |
| Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
| Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. | DESeq2, fold change > 2, FDR < 0.05 | WBPaper00065835:Day11_vs_Day1_downregulated | |
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
| mitochondrial sulfide delivery molecule (mtH2S) AP39 | Transcripts that showed significantly increased expression in N2 animals treated with mitochondrial sulfide delivery molecule (mtH2S) AP39 starting from 1-day-post L4 until 11 days post L4. | DESeq2, fold change > 2, FDR < 0.05 | WBPaper00065835:mtH2S-AP39-D0-treatment_upregulated_Day11 |
| Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:pharynx_expressed | |
| Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). | For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). | WBPaper00040858:eQTL_age_regulated_developing | |
| Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141) | |
| Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:seam_expressed | |
| Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade). | For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). | WBPaper00040858:eQTL_regulated_developing | |
| Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage. | DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01. | WBPaper00056169:rrf-3(pk1426)_upregulated_embryo | |
| Bacteria infection: Bacillus thuringiensis | Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304. | N.A. | WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated |
| Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. | Fold change > 2. | WBPaper00064306:Agaro-oligosaccharides_upregulated | |
| Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. | DESeq2, fold change > 2, p-value < 0.01. | WBPaper00061203:sin-3(tm1276)_upregulated | |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h |
| Dietary restriction | Transcripts that showed significantly decreased expression after N2 animals were under dietary restriction (DR, OP50 OD = 0.1) from 3-day post L4 till 6-day post L4 adult hermaphrodite stage, comparing to under ad libtum (AL, OP50 OD = 3) condition. | Bioconductor package edgeR, p < 0.05. | WBPaper00056443:DietaryRestriction_downregulated |
| Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated | |
| Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals. | Sleuth | WBPaper00051558:aging_regulated | |
| Transcripts enriched in AMso according to single cell RNAseq. | Genes that pass the Bonferroni threshold for multiple comparisons (q < 0.05) are significantly enriched. | WBPaper00061651:AMso_enriched |
17 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Expr1031206 | Tiling arrays expression graphs | |||
| Also expressed in (comments from author) : No comments. Strain: BC14131 | [F10C1.2a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCGATCAACTATTAACTGAACCA] 3' and primer B 5' [AGCCTCCATTTCTGATGTGTTT] 3'. | Expr5713 | Adult Expression: rectal epithelium; hypodermis; seam cells; excretory cell; Larval Expression: rectal epithelium; hypodermis; seam cells; excretory cell; | |
| Cannot find sequence info for IF B1 in this article. --wjc. Protein_Description: Intermediate Filament gene B1. Reporter gene fusion type not specified. The same structures were seen in immunofluorescence experiments with a B1-specific antibody. This antibody recognized in immunoblots the recombinant protein B1a and two closely spaced bands in a total nematode extract. | Expr1497 | The B1 promoter-driven GFP staining was seen in cells associated with the amphid sensory neurons, the excretory cells, the vulva, and the uterus and, finally, in the rectum and some neurons of the tail. In the pharynx, staining localized to the marginal cells and the pharyngeal-intestinal valve. | ||
| IFB-1BDGFP data were collected using the pCZ482 extrachromosomal array juEx595. | Expr2857 | IFB-1ADGFP was first detected in epidermal cells at the enclosure stage of embryogenesis. By the 1.5-fold stage, IFB-1ADGFP began to accumulate in regions of epidermal cells adjacent to body wall muscles. In addition to epidermal and pharyngeal expression, both IFB-1 isoforms were expressed in other cell types. Both isoforms were localized to the processes of the excretory cell and the excretory duct. IFB-1B, but not IFB-1A, transgenes were highly expressed in the uterine epithelium. Prominent expression of IFB-1 isoforms was also observed in the pharynx. Both IFB-1A and IFB-1B are expressed in marginal cells of the pharynx. IFB-1BDGFP transgenes were expressed throughout the length of the pharynx, whereas IFB-1ADGFP transgenes were expressed in a subset of pharyngeal marginal cells. In pharyngeal marginal and muscle cells, Myotactin is localized basally, whereas IFB-1ADGFP and IFB-1BDGFP were distributed throughout the apicalbasal axis. These data confirm previous reports of anti-IFB-1 staining in pharyngeal marginal cells. | In embryos after the 2-fold stage, larvae, and adults, IFB-1ADGFP localized to circumferential stripes in the parts of the epidermis that contact body wall muscles and in double tracks corresponding to epidermis overlying the processes of mechanosensory neurons; these patterns of subcellular localization correspond to epidermal attachment structures, also known as fibrous organelles. IFB-1BDGFP was also expressed in the epidermis in a pattern indistinguishable from that of IFB-1A. Thus, both isoforms of IFB-1 are expressed in the epidermis and localized to the same subcellular compartments. The monoclonal antibody MH4 recognizes an epitope common to IFA-1, IFA-2, and IFA-3, and does not recognize IFB-1. MH4 staining and IFB-1ADGFP expression co-localized in both embryonic and adult epidermal cells. In the adult epidermis, IFB-1ADGFP partly co-localized with Myotactin, a transmembrane protein that localizes to or close to the basal parts of epidermal attachments. | |
| Expr2763 | The B1a promoter/gfp reporter was strongly expressed in the embryonic and the early larval hypodermis. Additional expression was seen in cells associated with the amphid sensory neurons, the excretory cells, the vulva, the nerve cord and the rectum, as well as in some neurons of the tail of the late larva or the juvenile. A similar expression pattern was detected in adults, which, however, lacked the hypodermal expression seen at earlier developmental stages. | |||
| Expr15156 | We found that the two isoforms IFB-1A and IFB-1B, fused to GFP and directed by their own promoters, were similarly expressed in canals, albeit differentially in other tissues. Both IFB-1A and IFB-1B were absent at lumen initiation and first appeared in laterally extending canals, where they persisted through anterior-posterior canal extension and thereafter. Double-labeling canals with cytoplasmic mCherry localized both GFP-labeled isoforms to the lumen. | |||
| Expr12515 | IFB-1::GFP is expressed in fibrous organelles (hemidesmosomes), uterine seam, and the excretory canal. | |||
| Expr2012679 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr1011188 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Expr2030915 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr1148176 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Expr1200364 | Data from the TransgeneOme project | |||
| Expr1200365 | Data from the TransgeneOme project | |||
| Expr15158 | To optimize comparative imaging of all canal cIFs and their isoforms during canal lumenogenesis, ifa-4, ifb-1b, ifc-2a, and ifc-2b cDNAs were cloned behind the canal-specific sulp-5 promoter and fused to different fluorophores. All localized to expanding larval and fully expanded adult lumenal membranes adjacent to but distinct from lumenal ERM-1. Thus, all C. elegans canal cIFs and their isoforms are located at the lumen. | |||
| No detailed description on cellular expression patterns in other tissue. | Expr2858 | Anti-IFB-1 was previously reported to stain several non-epidermal cell types. Anti-IFB-1 staining in these cells was confirmed; however, in addition, consistent anti-IFB-1 staining was observed in epidermal attachment structures. The expression patterns of the GFP-tagged IFB-1 transgenes support the conclusion that this anti-IFB-1 staining in epidermal cells is specific. | Expressed in epidermal attachment structures. | |
| Original chronogram file: chronogram.725.xml | [F10C1.2:gfp] transcriptional fusion. | Chronogram1814 | ||
| Expr1170026 | Time-lapse fluorescence microscopy was performed, including DIC for morphology. Gene expression patterns were summarized in 4 manners: Average over time, Average over time and at different positions along the anterior-posterior (AP) axis, a voxelized representation over time, and on individual cells overlaid from a reference coordinate dataset (https://doi.org/10.1016/j.ydbio.2009.06.014). The analysis was done with a pipeline based on the multi-purpose image analysis software Endrov (https://doi.org/10.1038/nmeth.2478), which further is needed to browse the raw recording data. Thumbnail movies were also generated, using maximum Z projection for the 3D fluorescence channel. Raw recordings available in the Endrov OST-file format are available at https://www.ebi.ac.uk/biostudies/studies/S-BIAD191?query=S-BIAD191 |
16 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| enables | |
| enables | |
| enables | |
| involved_in | |
| located_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| enables | |
| involved_in | |
| part_of(WBbt:0005812) | located_in |
| located_in | |
| located_in | |
| located_in | |
| located_in |
13 Homologues
| Type |
|---|
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |