WormMine: Gene WBGene00003024

• WormBase Gene ID: WBGene00003024
• Gene Name: lin-39
• Sequence Name: C07H6.7
• Brief Description: lin-39 encodes a homeodomain protein homologous to the Deformed and Sex combs reduced family of homeodomain proteins; lin-39 is required cell autonomously for specification of mid-body region cell fates, including those of the VC neurons and the vulval precursor cells (VPCs), during postembryonic development; lin-39 activity is also required for normal migration of the QR, and to a lesser extent QL, neuroblasts and their descendants; in regions of the body where lin-39 expression overlaps with that of mab-5, another C. elegans HOM-C gene, the two genes appear to either compensate for one another's activity or act combinatorially to promote cell fates distinct from those where either gene is expressed alone; lin-39 transcripts are detected at all development stages, and a lin-39:lacZ reporter fusion is expressed in cells of the central body region, including ventral cord neurons and ventral epidermal cells, from mid-embryogenesis through larval and adult stages.
• Organism: Caenorhabditis elegans
• Automated Description: Enables cis-regulatory region sequence-specific DNA binding activity. Involved in several processes, including positive regulation of DNA-templated transcription; positive regulation of developmental process; and regulation of cell division. Located in nucleus. Expressed in several structures, including hypodermis; male-specific anatomical entity; neurons; somatic nervous system; and ventral cord blast cell. Is an ortholog of human HOXA5 (homeobox A5).
• Biotype: SO:0001217
• Genetic Position: III :-0.674053 ±0.004322
• Length (nt): 7992

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003024

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C07H6.7.2	C07H6.7.2	1342	III: 7528641-7534805
Transcript:C07H6.7.1	C07H6.7.1	1280	III: 7528641-7536632

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C07H6.7	C07H6.7	762	III: 7529116-7529202

22 RNAi Result

• WBRNAi00059887
• WBRNAi00066067
• WBRNAi00068157
• WBRNAi00040047
• WBRNAi00008366
• WBRNAi00024502
• WBRNAi00086869
• WBRNAi00086868
• WBRNAi00022932
• WBRNAi00022933
• WBRNAi00022934
• WBRNAi00006762
• WBRNAi00066005
• WBRNAi00027677
• WBRNAi00114669
• WBRNAi00084135
• WBRNAi00084137
• WBRNAi00066003
• WBRNAi00066007
• WBRNAi00084127
• WBRNAi00084126
• WBRNAi00107341

155 Allele

• gk964518
• gk963887
• gk963601
• gk963602
• gk547440
• gk597794
• gk351060
• gk582315
• WBVar00563934
• WBVar01408875
• gk466112
• gk341075
• gk690371
• gk645742
• WBVar02012959
• gk763834
• gk879097
• gk328729
• gk665601
• gk538117
• gk603412
• gk637304
• gk919130
• gk799222
• WBVar02078995
• gk439874
• gk818063
• gk893206
• gk430968
• gk862017

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003024
• Start: 7528641
• End: 7536632
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_7527426..7528640
• Length (nt): 1215
• Chromosome Location: III: 7527426-7528640
• Organism: Caenorhabditis elegans

151 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Significantly upregulated genes from clk-1(qm30) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips.	SAM algorithm with an FDR < 0.1.	WBPaper00033065:clk-1(qm30)_upregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Transcripts that showed significantly increased expression in mbl-1(syb4318), referred to as mbl-1short(ex7-), comparing to in N2 at L4 larva stage.	DESeq2, Fold change > 2 and FDR < 0.05	WBPaper00066410:mbl-1(syb4318)_upregulated
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Transcripts that showed significantly increased expression in mep-1(ne4629[MEP-1-GFP-Degron]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:mep-1(ne4629)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed
	Transcripts that showed significantly decreased expression in rbr-2(tm3141) comparing to in N2 animals.	Mapped reads were analyzed for transcript assembly and differential expression using Cufflinks 2.1.1 with a filter of twofold difference and FDR correction (P < 0.05).	WBPaper00050080:rbr-2(tm3141)_downregulated
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Allantoin_downregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts of coding genes that showed significantly increased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_enriched_coding-RNA
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes

43 Expression Patterns

• Primary Identifier: Expr5204
• Remark: Strain: BC11630
• Reporter Gene: [lin-39::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGGTGAGGCACTGCTGG] 3' and primer B 5' [TGTGGTGATCTGGAGTGAAAAC] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine; body wall muscle

• Primary Identifier: Expr1031414
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr7422
• Remark: Clone: pUL#JRH4D11
• Pattern: Early embryos show GFP expression in several cells; hypodermal cells express from late embryo to L2; all postembryonic stages show expression in dorsal nerve cord and a cell in the nerve ring.

• Primary Identifier: Expr16257
• Pattern: For lin-39 and mab-5, previous work reported their partially overlapping expression in the ventral cord motor neurons (MNs). In this study, we used two fosmid reporters wgIs18[lin39::EGFP] and wgIs27[mab-5::EGFP] to map their expression to the single-cell resolution among the 75 motor neurons (MNs), which include 54 cholinergic MNs, 19 GABAergic MNs, and 2 serotonergic MNs with stereotypical positions. These MNs can be further classified into eight neuron classes (DA, DB, VA, VB, AS, VC, DD, and VD). By crossing the GFP reporters with mCherry strains labelling cholinergic or GABAergic neurons in the ventral cord, we identified lin-39 expression in DA2-5, DB2-7, VA3-8, VB4-9, AS2-8, VC1-6, DD2-6, and VD3-12 and mab-5 expression in DA4-8, DB5-7, VA6-11, VB8-11, AS5-11, VC3-6, DD2-6, and VD2-12. Both lin-39 and mab-5 expression were generally weaker in more anterior MNs. Interestingly, for cholinergic MNs, mab-5 and lin-39 expression only overlapped in a set of mid-body MNs; MNs more anterior to this region expressed only lin-39 and MNs more posterior expressed only mab-5. For GABAergic MNs (DD and VD), however, lin-39and mab-5 expression overlapped entirely. Outside of the ventral nerve cord, lin-39 was expressed in AQR and AIYL/R in the head and AVM, SDQL/R, PDEL/R, and PVDL/R neurons along the body; mab-5 was expressed in the AVL in the head, SDQL in the mid-body region, and PQR neuron in the tail.

• Primary Identifier: Expr15628

• Primary Identifier: Expr15002
• Pattern: Animals carrying lin-39::mNG::3xFLAG::AID display no developmental phenotypes and show nuclear mNG expression in MNs located at the mid-body region of the VNC during development and adult stages.

• Primary Identifier: Expr11423
• Remark: Feature : "ceh-13/lin-39_temp_I1"
• Pattern: Region I1 drove expression in seam cells, starting with the embryo and continuing through to young adults.

• Primary Identifier: Expr11422
• Remark: Feature : "ceh-13/lin-39_temp_I0"
• Pattern: Region I0 drove expression in the ventral posterior coelomocytes and the two anterior inner longitudinal muscles of the male tail.

• Primary Identifier: Expr11421
• Remark: Feature : "ceh-13/lin-39_temp_N11"
• Pattern: Region N11 was in the proximal promoter region of ceh-13 and drove expression in the anterior hypodermis of late embryos.

• Primary Identifier: Expr11417
• Remark: Feature : "ceh-13/lin-39_temp_N3"
• Pattern: Region N3 was expressed in the hypodermal hyp7 cells in the late embryo and early L1 larvae as well as in the V cells, P cells, and ventral nerve cord of the early L1 through L3 larvae.

• Primary Identifier: Expr11429
• Remark: Feature : "lin-39_temp_pJW6"
• Pattern: pJW6 contains a 3.4-kb fragment located between 2.0 and 5.4 kb upstream of lin-39 that directs expression in P5.p and P6.p and the syncytial hypodermis, however, expression was observed in few animals (<20%).

• Primary Identifier: Expr1200038
• Pattern: Data from the TransgeneOme project

• Primary Identifier: Expr11418
• Remark: Feature : "ceh-13/lin-39_temp_N4"
• Pattern: Region N4 is in the proximal promoter region of lin-39; it drove expression in the ventral mid-body of the early embryo shortly after gastrulation. During early larval development N4 also drove expression in V6.

• Primary Identifier: Expr11419
• Remark: Feature : "ceh-13/lin-39_temp_N7"
• Pattern: Region N7 drove expression in the posterior bodywall muscle cells, starting in the late embryo and continuing through adulthood, and in the diagonal and longitudinal muscles of the male tail.

• Primary Identifier: Expr11420
• Remark: Feature : "ceh-13/lin-39_temp_N9"
• Pattern: Region N9 drove previously reported embryonic expression, along with previously unreported anterior body wall muscle expression in L4 larvae and adults.

• Primary Identifier: Expr11426
• Remark: Feature : "ceh-13/lin-39_temp_W2"
• Pattern: W2, a large region spanning N7, N8, and N9, directs expression in both the anterior and posterior body wall muscles, demonstrating additive coexpression of N7 and N9.

• Primary Identifier: Expr11415
• Remark: Feature : "ceh-13/lin-39_temp_N1"
• Pattern: The intronic element N1 drove expression in vulval muscle, starting during the L4 larval stage and continuing through the adult.

• Primary Identifier: Expr11416
• Remark: Feature : "ceh-13/lin-39_temp_N2"
• Pattern: Region N2 was expressed in the ventral nerve cord during the L1 larval stage. Expression of region N2 was also seen in some P cells and in the neural precursor Q cells.

• Primary Identifier: Expr11430
• Remark: Feature : "lin-39_temp_pJW8"
• Pattern: pJW8 contains the 1.6 kb first lin-39 intron, which directs GFP expression in a subset of VCNs.

• Primary Identifier: Expr11560
• Pattern: Expressed in ventral cord neurons, sex myoblasts, P cells, vulval precursor cells; 2 head neurons.

• Primary Identifier: Expr3876
• Pattern: Around the mid L3 stage, GFP expression was also seen in two sex myoblasts located in the mid body region. Expression was highly penetrant and persisted in the sex myoblast descendants as they divided. GFP expression in these cells faded in the L4 stage and was not seen in differentiated vulval or uterine muscles. After the P cells divided in the L1, GFP expression can be observed in a subset of ventral cord neurons (VCNs). Expression in some neurons along the ventral cord persisted during the L2 stage, became more penetrant in the L3 stage, and remained throughout development even in the adult. Expression was also seen in a neuron in the head, which was reported previously. Authors did not examine GFP expression in the Q lineage, or in males. GFP expression was detected in P3/4 only when deIs4 was moved into a smg-1 mutant, in which nonsense-mediated RNA decay is compromised, suggesting that either there is less transcription of lin-39 in P3 and P4 (and their descendants), or more nonsense-mediated decay of the transcript from deIs4 in those cells. Once the P cells divided, GFP expression was observed in 50% of P3.p cells, 70% of P4.p cells, and 100% of P5.p to P8.p cells in smg-1; deIs4 (n>30) with similar levels of expression in P5.p to P8.p. Other lin-39 reporters also show this lower level of expression in P3.p and P4.p. This pattern of expression persisted throughout the L2 stage until the time of vulval induction in the L3 stage. At this time (29 h, post-hatching), GFP expression was stronger in P6.p than the other VPCs, showing that lin-39 upregulation occurred with these reporters. When the induced VPCs (P5.p to P7.p) start dividing, GFP expression remained in their daughters, with higher levels of GFP in P6.p descendants and lower levels in P5.p and P7.p descendants, even after the second and third divisions. In addition, increased GFP expression was seen during the late L3 stage in P5.paax and P7.pppx, the cells that fuse to form the VulA vulval cell, and this pattern remained until the late L4 stage. During vulval morphogenesis in the L4 stage, GFP was maintained in the 22 cells that form the vulval invagination only in the smg-1 background. GFP expression were detected in the P cells, VPCs, ventral cord neurons (VCNs), sex myoblasts and their descendants, and a head neuron shown to express lin-39. GFP expression were first detected early in the embryo in cells likely to be P5 to P8. This expression continued during embryogenesis and after hatching until the division of the P cells in the L1 stage.

• Primary Identifier: Expr9273
• Pattern: LIN-39 protein levels were not uniform among vulval precursor cells. P3.p and P4.p displayed the lowest LIN-39 levels, and the level of LIN-39 in P4.p was not significantly higher than that in P3.p. Surprisingly, the LIN-39 level was the highest in P5.p and decreased from P5.p to P8.p. At a later developmental time (late L2 larvae), as previously reported, the LIN-39 peak was found on P6.p.

• Primary Identifier: Expr15005
• Pattern: Animals carrying lin-39::mNG::3xFLAG::AID display no developmental phenotypes and show nuclear mNG expression in MNs located at the mid-body region of the VNC during development and adult stages.

• Primary Identifier: Expr10499
• Pattern: Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/

• Primary Identifier: Chronogram712
• Remark: Original chronogram file: chronogram.1743.xml
• Reporter Gene: [C07H6.7:gfp] transcriptional fusion.

• Primary Identifier: Chronogram913
• Remark: Original chronogram file: chronogram.1961.xml
• Reporter Gene: [C07H6.7:gfp] transcriptional fusion.

• Primary Identifier: Expr2729
• Remark: Also cited by Alper and Kenyon, 2002, Development: 'lin-39 is expressed in P(3-8).p in both sexes'
• Pattern: In embryos, larvaes and adults, expression was observed in the central body region.

• Primary Identifier: Expr1644
• Pattern: Before vulval induction occurs, lin-39 was expressed uniformly in the VPCs. At the time of vulval induction, lin-39 expression increased dramatically in P6.p. P3.p, P4.p, and P8.p showed the lowest levels of lin-39 expression.

• Primary Identifier: Expr11428
• Remark: Feature : "WBsf047653" // lin-39_temp_pJW5
• Pattern: pJW5 contains a 1.3-kb fragment located between 5.1 and 6.4 kb upstream of the lin-39 ATG that drives GFP expression in P6.p at the time of vulval induction and in the sex myoblasts descendants.

• Primary Identifier: Expr11424
• Remark: Feature : "ceh-13/lin-39_temp_I4"
• Pattern: Region I4 drove expression in the sex myoblasts through two cell divisions, as previously described by Wagmaister et al. (2006). Although expression was also reported in the Pn.p cells, it was not observed in this study, perhaps because I4 was not identical to the pJW5 region assayed by Wagmaister et al. (2006).

26 GO Annotation

16 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003024
• Start: 7528641
• End: 7536632
• Strand: -1

26 Ontology Annotations

1 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Binding targets of LIN-39, according to ChIP-Seq analysis.	N.A.	WBPaper00037946:LIN-39_interacting

1 Sequence

• Length: 7992

1 Sequence Ontology Term