WormMine: Gene WBGene00003175

• WormBase Gene ID: WBGene00003175
• Gene Name: mec-12
• Sequence Name: C44B11.3
• Brief Description: mec-12 encodes an alpha-tubulin; MEC-12 is required for normal mechanosensory response to gentle touch, and specifically for formation of the 15-protofilament microtubule bundle present in the touch receptor neurons; mec-12 interacts genetically with mec-5, which encodes a unique C. elegans collagen secreted by the hypodermis; MEC-12 is highly expressed in the touch neurons as well as in several other neurons that do not contain the microfilament bundle, such as the ventral cord motorneurons; MEC-12 is acetylated in a manner that is dependent upon MEC-17 and W06B11.1, which encode paralogous alpha-tubulin acetyltransferases.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable GTP binding activity. Predicted to be a structural constituent of cytoskeleton. Involved in several processes, including positive regulation of multicellular organismal process; response to mechanical stimulus; and thigmotaxis. Located in axon; microtubule; and neuronal cell body. Expressed in nerve ring; neurons; and in male. Human ortholog(s) of this gene implicated in several diseases, including Down syndrome; amyotrophic lateral sclerosis type 22; and lissencephaly 3. Is an ortholog of human TUBA3C (tubulin alpha 3c) and TUBA3D (tubulin alpha 3d).
• Biotype: SO:0001217
• Genetic Position: III :-7.49759 ±0.038654
• Length (nt): 7661

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003175

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C44B11.3.1	C44B11.3.1	1612	III: 3131574-3139234

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C44B11.3	C44B11.3	1353	III: 3131733-3132029

8 RNAi Result

• WBRNAi00042413
• WBRNAi00068805
• WBRNAi00011904
• WBRNAi00076212
• WBRNAi00006557
• WBRNAi00027703
• WBRNAi00068743
• WBRNAi00117198

180 Allele

• gk962532
• gk964281
• WBVar02067443
• WBVar01261290
• WBVar01261293
• WBVar01261294
• WBVar01261297
• WBVar01329776
• WBVar01329777
• WBVar01329778
• WBVar01329779
• WBVar01329782
• WBVar01541404
• WBVar01541405
• WBVar01541402
• WBVar01541403
• WBVar01541400
• WBVar01541401
• WBVar01541397
• WBVar01541398
• WBVar01541399
• WBVar01656090
• u765
• e1605
• WBVar00044046
• e1607
• WBVar01952015
• u67
• WBVar00044051
• u63

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003175
• Start: 3131574
• End: 3139234
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

296 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_larva_enriched
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:AVE-neuron_L1-larva_expressed
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA.	Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference.	WBPaper00045974:NSM_enriched_totalRNA_RNAseq
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_aging
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade).	Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118.	WBPaper00040858:eQTL_regulated_reproductive
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo

10 Expression Patterns

• Primary Identifier: Expr4856
• Pattern: A-class motor neuron: expressed in embryo; enriched in larva (1.9). Neuronal expression include: L2 -- DA, VA, VB, VD, bright in touch neurons, head and tail neurons L3 -- all ventral cord motor neurons. Pan-neuronal: expressed in embryo; enriched in larva (5.9).

• Primary Identifier: Expr5493
• Remark: Strain: BC10751
• Reporter Gene: [mec-12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCCCAGACAGGAGCTGAA] 3' and primer B 5' [TTGCAAAAGAGGAGCTACAAGTT] 3'.
• Pattern: Adult Expression: intestine; Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; Larval Expression: intestine; Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr1031506
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1269
• Pattern: Strong levels of expression in the six touch receptor neurons. In addition, staining was detectable in several other neurons, including motorneurons of the ventral cord such as members of the DB class, various neurons of the nerve ring region, and a few neurons of the lumbar ganglion such as PVR. No expression was detected in ALN and FLP neurons.

• Primary Identifier: Expr16375
• Pattern: We observed the expression of the mec-12 gene and protein in PHA in males.

• Primary Identifier: Chronogram511
• Remark: Original chronogram file: chronogram.1527.xml
• Reporter Gene: [C44B11.3:gfp] transcriptional fusion.

• Primary Identifier: Expr2013489
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1022948
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2031723
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1146401
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

43 GO Annotation

12 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003175
• Start: 3131574
• End: 3139234
• Strand: -1

43 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 7661

1 Sequence Ontology Term