WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00003375 Gene Name  mlp-1
Sequence Name  ? T04C9.4 Brief Description  mlp-1 encodes a LIM domain-containing protein that is a member of the MLP/CRP family of muscle LIM domain proteins.
Organism  Caenorhabditis elegans Automated Description  Predicted to enable metal ion binding activity. Located in striated muscle dense body. Human ortholog(s) of this gene implicated in dilated cardiomyopathy 1M and hypertrophic cardiomyopathy 12. Is an ortholog of human CSRP1 (cysteine and glycine rich protein 1); CSRP2 (cysteine and glycine rich protein 2); and CSRP3 (cysteine and glycine rich protein 3).
Biotype  SO:0001217 Genetic Position  III :-1.42778 ±0.000247
Length (nt)  ? 3529
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00003375

Genomics

7 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:T04C9.4a.1 T04C9.4a.1 592   III: 5971527-5973663
Transcript:T04C9.4d.1 T04C9.4d.1 520   III: 5971527-5973665
Transcript:T04C9.4b.1 T04C9.4b.1 538   III: 5971528-5973663
Transcript:T04C9.4c.1 T04C9.4c.1 537   III: 5971535-5973663
Transcript:T04C9.4c.2 T04C9.4c.2 572   III: 5971537-5975055
Transcript:T04C9.4a.2 T04C9.4a.2 1310   III: 5971539-5973665
Transcript:T04C9.4a.3 T04C9.4a.3 347   III: 5971730-5973665
 

Other

4 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:T04C9.4b T04C9.4b 342   III: 5971723-5971780
CDS:T04C9.4c T04C9.4c 348   III: 5971723-5971780
CDS:T04C9.4d T04C9.4d 321   III: 5971723-5971780
CDS:T04C9.4a T04C9.4a 288   III: 5972558-5972730

13 RNAi Result

WormBase ID
WBRNAi00052381
WBRNAi00052382
WBRNAi00018138
WBRNAi00018139
WBRNAi00076643
WBRNAi00006779
WBRNAi00006909
WBRNAi00109560
WBRNAi00035133
WBRNAi00109171
WBRNAi00109269
WBRNAi00109366
WBRNAi00109463

55 Allele

Public Name
gk964518
gk175757
gk175758
gk175754
gk175755
gk175756
gk964338
gk964339
tm11247
WBVar01264137
WBVar01264136
WBVar01264138
WBVar01264135
WBVar01264134
WBVar01264142
WBVar01264141
otn427
gk856879
gk651791
gk695764
gk338819
gk358656
gk833900
gk784177
gk469260
gk702449
gk838132
gk900499
gk486690
gk315657

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00003375 5971527 5975055 -1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_5971512..5971526   15 III: 5971512-5971526 Caenorhabditis elegans

238 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Genes with expression altered >= 3-fold in dpy-10(e128) mutants. Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). WBPaper00035873:dpy-10_regulated
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_NoFood
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:bodywall-muscle_L1-larva_expressed
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day5_vs_Day1_downregulated
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day11_vs_Day1_downregulated
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Genes up regulated in alg-1(gk214) comparing to in N2. Differential expression was assessed using an empirical Bayes statistics using the eBayes function. WBPaper00040823:alg-1(gk214)_upregulated
  Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:pharynx_expressed
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_developing
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
  Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:seam_expressed
  Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_regulated_developing
  Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage. DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01. WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
Bacteria infection: Bacillus thuringiensis Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304. N.A. WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
  Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. Fold change > 2. WBPaper00064306:Agaro-oligosaccharides_upregulated
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
  mRNAs that showed increased expression in P-granule RNAi animales (simultaneously targeting pgl-1, pgl-3, glh-1 and glh-4) comparing to in control RNAi animals. Set 1 transcripts were defined as P-value < 0.05 and fold change > 2. DESeq was used. Fold change between the average of the four control replicates and the average of the four test replicates was used to calculate the significance using a negative binomial distribution. An adjusted P-value was calculated using the Benjamini-Hochberg method for multiple testing correction. WBPaper00046805:P-granule-RNAi_upregulated_Set1
  Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2. To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. WBPaper00047131:daf-2(e1370)_upregulated_N2-background
  Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. DESeq2 version 1.22.2, p < 0.05 WBPaper00064716:paraquat_downregulated
  Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals. NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%. WBPaper00064727:daf-2(e1370)_upregulated

11 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr1031554 Tiling arrays expression graphs  
Strain: BC11742 [mlp-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTTCCTCCTCCAACAAAATCTTA] 3' and primer B 5' [GGCTTGAATGGGATTCTGG] 3'. Expr6601 Adult Expression: intestine; rectal gland cells; Reproductive System; vulval muscle; spermatheca; body wall muscle; hypodermis; Nervous System; head neurons; neurons along body; tail neurons; Larval Expression: intestine; rectal gland cells; body wall muscle; Nervous System; head neurons; tail neurons;  
Strain: BC11257 [mlp-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTTCCTCCTCCAACAAAATCTTA] 3' and primer B 5' [GGCTTGAATGGGATTCTGG] 3'. Expr6602 Adult Expression: pharynx; intestine; anal depressor muscle; body wall muscle; Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle;  
Strain: BC12705 [mlp-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTTCCTCCTCCAACAAAATCTTA] 3' and primer B 5' [GGCTTGAATGGGATTCTGG] 3'. Expr6603 Adult Expression: pharynx; anal depressor muscle; Reproductive System; spermatheca; gonad sheath cells; body wall muscle; Larval Expression: pharynx; anal depressor muscle; body wall muscle;  
    Expr9393 Adult Expression: intestine; rectal gland cells; Reproductive System; vulval muscle; spermatheca; body wall muscle; hypodermis; Nervous System; head neurons; neurons along body; tail neurons. Larval Expression: intestine; rectal gland cells; body wall muscle; Nervous System; head neurons; tail neurons; Sub-cellular localization within the body wall muscle: Dense bodies, Cytoplasm, +/- Nucleus
Original chronogram file: chronogram.1705.xml [T04C9.4:gfp] transcriptional fusion. Chronogram676    
    Expr1156008 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2013600 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr2031833 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Original chronogram file: chronogram.2156.xml [T04C9.4:gfp] transcriptional fusion. Chronogram1091    
    Expr1024939 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

4 GO Annotation

Annotation Extension Qualifier
  located_in
part_of(WBbt:0006804) located_in
  enables
part_of(WBbt:0006804) located_in

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00003375 5971527 5975055 -1

4 Ontology Annotations

Annotation Extension Qualifier
  located_in
part_of(WBbt:0006804) located_in
  enables
part_of(WBbt:0006804) located_in

0 Regulates Expr Cluster

1 Sequence

Length
3529

1 Sequence Ontology Term