WormMine: Gene WBGene00003893

• WormBase Gene ID: WBGene00003893
• Gene Name: ost-1
• Sequence Name: C44B12.2
• Brief Description: ost-1 encodes the C. elegans ortholog of the conserved basement membrane glycoprotein component osteonectin/SPARC/BM-40; loss of ost-1 function via RNAi indicates that ost-1 activity is required for embryonic and larval development, as well as for normal gut development, body size, and fecundity; an OST-1::GFP reporter fusion protein localizes to the basement membranes along body wall and sex muscles, as well as around the pharynx and gonad, with particular concentration at the spermatheca and distal tip cells.
• Organism: Caenorhabditis elegans
• Automated Description: Enables calcium ion binding activity. Located in basement membrane and extracellular space. Expressed in body wall musculature; gonad; head; pharynx; and vulval muscle. Human ortholog(s) of this gene implicated in several diseases, including carcinoma (multiple); osteogenesis imperfecta type 17; and progressive osseous heteroplasia. Is an ortholog of human SPARC (secreted protein acidic and cysteine rich).
• Biotype: SO:0001217
• Genetic Position: IV :-22.0306 ±0.044335
• Length (nt): 3477

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003893

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C44B12.2a.1	C44B12.2a.1	1153	IV: 1107396-1110872
Transcript:C44B12.2b.1	C44B12.2b.1	534	IV: 1108938-1110567

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C44B12.2b	C44B12.2b	534	IV: 1108938-1108946
CDS:C44B12.2a	C44B12.2a	795	IV: 1107449-1107511

4 RNAi Result

• WBRNAi00064054
• WBRNAi00042417
• WBRNAi00001609
• WBRNAi00027583

92 Allele

• gk963722
• gk964482
• gk963025
• gk963557
• gk963558
• gk193463
• gk193462
• gk193461
• gk193460
• gk193466
• gk193465
• gk193464
• gk193469
• gk193468
• gk193467
• tm966
• WBVar00183480
• gk945428
• WBVar01825586
• WBVar01825584
• WBVar01825585
• tm6331
• gk953312
• WBVar01831428
• WBVar01831427
• WBVar02111367
• pk273
• WBVar01647506
• WBVar01510244
• WBVar01647507

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003893
• Start: 1107396
• End: 1110872
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_1110873..1111461
• Length (nt): 589
• Chromosome Location: IV: 1110873-1111461
• Organism: Caenorhabditis elegans

236 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
mitochondrial sulfide delivery molecule (mtH2S) AP39	Transcripts that showed significantly increased expression in N2 animals treated with mitochondrial sulfide delivery molecule (mtH2S) AP39 starting from 1-day-post L4 until 11 days post L4.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:mtH2S-AP39-D0-treatment_upregulated_Day11
	Genes up regulated in alg-1(gk214) comparing to in N2.	Differential expression was assessed using an empirical Bayes statistics using the eBayes function.	WBPaper00040823:alg-1(gk214)_upregulated
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
Bacteria infection: Bacillus thuringiensis	Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304.	N.A.	WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
Dietary restriction	Transcripts that showed significantly decreased expression after N2 animals were under dietary restriction (DR, OP50 OD = 0.1) from 3-day post L4 till 6-day post L4 adult hermaphrodite stage, comparing to under ad libtum (AL, OP50 OD = 3) condition.	Bioconductor package edgeR, p < 0.05.	WBPaper00056443:DietaryRestriction_downregulated

13 Expression Patterns

• Primary Identifier: Expr5494
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC11019
• Reporter Gene: [ost-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAGCAATAAACAAAACACATCTGG] 3' and primer B 5' [GACGGCGAATGAAGAGGA] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; vulval muscle; gonad sheath cells; body wall muscle; head mesodermal cell; unidentified cells in head; Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing uterus; gonad sheath cells; body wall muscle; head mesodermal cell; unidentified cells in head

• Primary Identifier: Expr1031836
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr707
• Remark: This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: Expression is first detected in unhatched larvae and was maintained throughout all larval stages and in adults. Staining was observed along the length of the nematode and was particularly strong in cells along the body wall where beta-gal also accumulates in a striated pattern in the cytoplasm. The striated pattern is identified as body wall muscle cells. In addition, sex muscle cells show staining. There are two clusters of nuclei visible on both sides of the vulva. Staining is observed around the pharynx but there is no staining observed in pharyngeal muscle.
• Subcellular Localization: beta-gal accumulates in a striated pattern in the cytoplasm. The striated pattern is identified as body wall muscle cells.

• Primary Identifier: Expr708
• Remark: This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: Localized diffusely along body muscle cells, concentrated at the boundaries between muscle cells. Staining limited to areas immediately adjacent to the body wall muscle. GFP protein also surrounds the sex muscles, which terminate at the vulva, detected in embryos and larvae. GFP localized around the pharynx, outlined the entire gonad and was particular prevalent at the spermatheca and the distal tip cell.
• Subcellular Localization: Concentrated at the boundaries between muscle cells.

• Primary Identifier: Expr14506
• Pattern: In C. elegans endogenous SPARC is produced primarily in the body wall and vulval muscles, and localize to the BMs surrounding all other tissues.

• Primary Identifier: Chronogram909
• Remark: Original chronogram file: chronogram.1956.xml
• Reporter Gene: [C44B12.2:gfp] transcriptional fusion.

• Primary Identifier: Expr14509
• Subcellular Localization: SPARC and collagen colocalize in intracellular vesicles in C. elegans. Much of the intracellular colocalization is likely rough ER, as SPARC::GFP colocalized with the ER marker TRAM::mCherry.

• Primary Identifier: Expr1010987
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram1478
• Remark: Original chronogram file: chronogram.354.xml
• Reporter Gene: [C44B12.2:gfp] transcriptional fusion.

• Primary Identifier: Expr2032883
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2014650
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1146405
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram1465
• Remark: Original chronogram file: chronogram.342.xml
• Reporter Gene: [C44B12.2:gfp] transcriptional fusion.

12 GO Annotation

9 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003893
• Start: 1107396
• End: 1110872
• Strand: 1

12 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 3477

1 Sequence Ontology Term