WormMine: Gene WBGene00004047

• WormBase Gene ID: WBGene00004047
• Gene Name: plx-1
• Sequence Name: Y55F3AL.1
• Brief Description: plx-1 encodes a C. elegans plexin ortholog; by homology, PLX-1 is predicted to function as a semaphorin receptor whose activity is required for proper positioning of the ray 1 cells in the male tail; genetic analyses indicate that while plx-1 functions in the same genetic pathway as the smp-1 and smp-2 semaphorin-encoding genes to position ray 1 cells, it functions in parallel to unc-73/GEF and the ced-10, mig-2, and rho-1 GTPase genes in affecting ray 1 position; plx-1 reporter gene fusions are expressed in all body wall muscles, male sex-specific muscles, and lateral hypodermal cells during postembryonic development; in the male tail, during the L3 larval stage when ray 1 cells are positioned, the plx-1 reporter is expressed predominantly in cells of the ray 1 and ray 2 lineages, with weaker and transient expression visible in the more posterior 3-9 rays.
• Organism: Caenorhabditis elegans
• Automated Description: Enables semaphorin receptor activity. Involved in epidermis development; nematode male tail mating organ morphogenesis; and nematode male tail tip morphogenesis. Located in ruffle membrane. Expressed in several structures, including DA9; epithelial cell; non-striated muscle; somatic nervous system; and tail. Is an ortholog of several human genes including PLXNA1 (plexin A1); PLXNA2 (plexin A2); and PLXNA3 (plexin A3).
• Biotype: SO:0001217
• Genetic Position: IV :-22.8796 ±0.031897
• Length (nt): 24875

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00004047

Genomics

6 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:Y55F3AL.1a.1	Y55F3AL.1a.1	6524	IV: 959521-984395
Transcript:Y55F3AL.1b.1	Y55F3AL.1b.1	6554	IV: 959521-984392
Transcript:Y55F3AL.1c.1	Y55F3AL.1c.1	5304	IV: 964323-983709
Transcript:Y55F3AL.1d.1	Y55F3AL.1d.1	5271	IV: 964323-983709
Transcript:Y55F3AL.1e.1	Y55F3AL.1e.1	3525	IV: 972383-983709
Transcript:Y55F3AL.1f.1	Y55F3AL.1f.1	3558	IV: 972383-983709

Other

6 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:Y55F3AL.1a	Y55F3AL.1a	5838	IV: 959521-959658
CDS:Y55F3AL.1d	Y55F3AL.1d	5271	IV: 964323-964441
CDS:Y55F3AL.1e	Y55F3AL.1e	3525	IV: 972383-972922
CDS:Y55F3AL.1b	Y55F3AL.1b	5871	IV: 959521-959658
CDS:Y55F3AL.1c	Y55F3AL.1c	5304	IV: 964323-964441
CDS:Y55F3AL.1f	Y55F3AL.1f	3558	IV: 972383-972922

7 RNAi Result

• WBRNAi00066949
• WBRNAi00057519
• WBRNAi00021029
• WBRNAi00077048
• WBRNAi00098896
• WBRNAi00098895
• WBRNAi00065916

673 Allele

• gk963722
• gk964482
• gk963025
• gk963557
• gk963558
• gk964114
• gk964115
• gk193158
• gk193157
• gk193162
• gk193161
• gk193160
• gk193159
• gk193166
• gk193165
• gk193164
• gk193163
• gk193169
• gk193168
• gk193167
• gk193173
• gk193172
• gk193171
• gk193170
• gk193196
• gk193198
• gk193197
• gk193202
• gk193201
• gk193200

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00004047
• Start: 959521
• End: 984395
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

81 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Genes that were downregulated in lin-15B(n744).	For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis.	WBPaper00038168:lin-15B(n744)_downregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_hrde-1(tm1200)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
Bacteria: B.thuringiensis	Transcripts in N2 animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407.	Cuffdiff	WBPaper00060358:B.thuringiensis_pathogen_regulated_N2
	Transcripts that showed significantly decreased expression in pfd-6(gk493446); daf-2(e1370) comparing to in daf-2(e1370).	Limma version 3.24.15. Fold change < 0.67 (p < 0.05).	WBPaper00055827:pfd-6(gk493446)_downregulated
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated
	Transcripts that showed decreased expression in hlh-11(ko1) knockout strain comparing to in wild type background.	DESeq2, FDR < 0.05	WBPaper00060683:hlh-11(ko1)_downregulated
	Transcripts of coding genes that showed significantly increased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_enriched_coding-RNA
	Genes that showed significantly altered expression between N2 and npr-1(ur89) strains exposed to either the nematocidal B. thuringiensis B-18247, the pathogenic P. aeruginosa PA14, or the control E. coli OP50 for 12 or 24 hours.	Estimation of transcript abundance and significantly differentially expressed genes were identified by Cuffdiff using the quartile normalization method. Transcripts with a significant change between different conditions (adjusted p-value < 0.01 by the false discovery rate, FDR) were treated as signature for each comparison.	WBPaper00049498:npr-1(ur89)_regulated_3
	Transcripts that showed significantly increased expression in jmjd-3.1p::jmjd-3.1 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:jmjd-3.1(+)_upregulated
	Transcripts that showed significantly increased expression in rgef-1p::jmjd-1.2 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:rgef-1p-jmjd-1.2(+)_upregulated
	Transcripts that showed significantly increased expression in sur-5p::jmjd-1.2 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:sur-5p-jmjd-1.2(+)_upregulated
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva stage	Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0129.	WBPaper00040858:eQTL_regulated_juvenile
	Transcripts enriched in germline by comparing dissected germline tissue with dissected intestine tissue, both injected with empty RNAi vector.	Genes were determined germline-enriched if the lowest expression value (log2(FPKM+1)) observed in the germline empty vector samples was at least 2-fold higher than the highest expression value observed in the intestine empty vector samples.	WBPaper00051039:germline_enriched
	Transcripts that showed significantly lower expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:hmc_biased
	Transcripts that showed significantly increased expression in lin-22(icb38) comparing to in N2 at L3 larva.	Differences in gene expression were then calculated using the negative binomial test in the DESeq package (FDR = 0.1).	WBPaper00053295:lin-22(icb38)_upregulated
	Transcripts that showed significantly increased expression in animals after 24 hour exposure to 100ug per ml silica nanoparticles (SiNPs).	The random variance model (RVM)t-test was applied toidentify differentially expressed mRNAs and miRNAsbetween the SiNPs-treated group and the control group. P-value <0.05 and fold change (FC) >1.5 were considered as the threshold screening between the SiNP-treated groupand the control group.	WBPaper00060100:SiNP_upregulated_mRNA
	Genes that showed flat mRNA expression level throughout the 16 hour time courses from L3 larva to young adult.	The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak.	WBPaper00044736:flat_dev_expression

13 Expression Patterns

• Primary Identifier: Expr1031947
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr4405
• Pattern: At the beginning of vulva morphogenesis, a strong expression from the plx-1::gfp transcriptional reporter is found in all migrating vulva cells.
• Subcellular Localization: As vulva morphogenesis progresses, expression from the plx-1p::PLX-1::GFP translational reporter increases at the plasma membrane of migrating vulva cell. However, although some signal is found on the entire cell membrane, PLX-1::GFP appears to be predominantly localized on the vulva center facing membrane (future lumen surface) of primordial vulva cells destined to enter the vulva proper. At the end of morphogenesis, PLX-1::GFP is predominantly expressed in the most ventral vulva rings [vulA, vulB1, vulB2, vulC and vulD (which are P5.p and P7.p derived)] and the signal is localized along the lumen formed by these cells.

• Primary Identifier: Expr7061
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC10792
• Reporter Gene: [plx-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAATCGCAATTTTTGCTGGT] 3' and primer B 5' [GGAGAAATGTGGGGATTTCAT] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; body wall muscle; Nervous System; head neurons; Larval Expression: pharynx; body wall muscle; seam cells; unidentified cells in tail

• Primary Identifier: Expr1884
• Remark: Another transgenic line independently established with the same construct also showed the similar patterns of EGFP expression.
• Pattern: EGFP expression was first observed at the lima bean stage in P and V epidermal cells and intestinal cells. In larvae, EGFP was expressed intensely in motoneurons in the ventral nerve cord and several neurons in the nerve ring and in the tail. The seam cells showed moderate EGFP expression throughout development. In hermaphrodites, vulval precursor cells and their descendants expressed EGFP intensely throughout development. In the male tail, R(n) cells and their descendants all expressed EGFP intensely.

• Primary Identifier: Expr2917
• Remark: Lineage expression: Rn descandents.
• Reporter Gene: [plx-1::gfp] transcriptional and translational fusion constructs. A plx-1 transcriptional gfp reporter was constructed by cloning the 2621 bp sequence immediately 5' to the initiation codon into the multiple cloning site of pPD95_77 to generate plasmid pPD95_77cplx. A plx-1(+) rescuing construct was assembled from multiple PCR fragments encompassing the entire coding sequence of Ce-PLX-1. The 3' portion of the construct comes from the cDNA yk535f1 and contains 739 bp of the 3'UTR. This plx-1(+) cDNA minigene was cloned downstream of the promoter sequence of the pPD95_77cplx transcriptional reporter to obtain the plasmid pZH127. The gfp coding sequence is out of frame in pZH127. The construct contains the full-length plx-1(+) minigene with 2621 bp of sequence immediately 5' to the initiation codon and 739 bp of the 3'UTR sequence. The GFP-encoding portion of pZH127 was put in frame with the PLX-1(+) sequence by fusing it after the PmlI site located four amino acids before the stop codon. For this, a SphI-KpnI fragment was deleted from pZH127, cut with PmlI and re-ligated in combination with a linker sequence into the SphI-KpnI cut pZH127 to obtain the new plx-1 translational reporter plasmid pZH157.
• Pattern: Expression of both reporters is observed in all body wall muscles, male sex specific muscles and in the lateral epidermis during post-embryonic development. At the third larval stage, male tail hypodermal expression begins in all dividing Rn.a and Rn.p cells although predominantly in R1.a and R1.p. The strongest expression of the transcriptional reporters is observed in the ray 1 cells. Expression of the transcriptional reporters in other rays is weak and eventually disappears. A similar effect is observed for the translational reporter, which expresses first and most highly on the ray 1 and ray 2 cells. Although the translational reporter is found on all rays at later stages of male tail development, this expression is weak relative to the earlier expression in precursors to rays 1 and 2.

• Primary Identifier: Expr3275
• Pattern: All the vulval precursor cells and their descendants, vulA-vulF, expressed GFP intensely throughout development. No intense expression was detected in hyp7.

• Primary Identifier: Expr10763
• Subcellular Localization: A functional PLX-1::GFP is localized to the dendrite, as well as to the proximal and distal axon, but is largely absent from the synaptic domain.

• Primary Identifier: Chronogram189
• Remark: Original chronogram file: chronogram.1219.xml
• Reporter Gene: [Y55F3AL.1:gfp] transcriptional fusion.

• Primary Identifier: Expr2014967
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1017090
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram1637
• Remark: Original chronogram file: chronogram.52.xml
• Reporter Gene: [Y55F3AL.1:gfp] transcriptional fusion.

• Primary Identifier: Expr2033202
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1160954
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

26 GO Annotation

24 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00004047
• Start: 959521
• End: 984395
• Strand: 1

26 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 24875

1 Sequence Ontology Term