WormMine: Gene WBGene00004788

• WormBase Gene ID: WBGene00004788
• Gene Name: sft-4
• Sequence Name: C54H2.5
• Brief Description: sft-4 encodes an integral membrane protein orthologous to Saccharomyces cerevisiae endoplasmic reticulum (ER)-to-Golgi cargo receptor Erv29p and mouse Surfeit-4 (Surf-4); by homology, SFT-4 is predicted to function as a cargo receptor that selectively transports proteins in COPII vesicles from the ER to the cis-Golgi; SFT-4 activity is required for larval development and for normal down regulation of the LET-23 EGF receptor in the secondary vulval cell lineages; an SFT-4::GFP reporter fusion localizes to the perinuclear region of the cytoplasm, consistent with localization to the endoplasmic reticulum.
• Organism: Caenorhabditis elegans
• Automated Description: Enables cargo receptor activity. Involved in several processes, including negative regulation of epidermal growth factor receptor signaling pathway; negative regulation of vulval development; and protein exit from endoplasmic reticulum. Located in endoplasmic reticulum exit site and perinuclear region of cytoplasm. Expressed in several structures, including head; hermaphrodite gonad; pharyngeal muscle cell; tail; and vulval precursor cell. Is an ortholog of human SURF4 (surfeit 4).
• Biotype: SO:0001217
• Genetic Position: X :-4.34017 ±0.013244
• Length (nt): 1848

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00004788

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C54H2.5.1	C54H2.5.1	1278	X: 5778875-5780722

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C54H2.5	C54H2.5	834	X: 5779309-5779453

35 RNAi Result

• WBRNAi00043197
• WBRNAi00074041
• WBRNAi00074040
• WBRNAi00074043
• WBRNAi00074042
• WBRNAi00074045
• WBRNAi00074044
• WBRNAi00074046
• WBRNAi00072391
• WBRNAi00062749
• WBRNAi00062750
• WBRNAi00071680
• WBRNAi00076243
• WBRNAi00111985
• WBRNAi00030272
• WBRNAi00071618
• WBRNAi00074039
• WBRNAi00111984
• WBRNAi00024907
• WBRNAi00001744
• WBRNAi00087003
• WBRNAi00087005
• WBRNAi00087004
• WBRNAi00008555
• WBRNAi00090716
• WBRNAi00090729
• WBRNAi00090724
• WBRNAi00087006
• WBRNAi00087007
• WBRNAi00087192

39 Allele

• gk964260
• WBVar01601801
• WBVar01601800
• tm823
• tm7409
• gk772717
• gk505702
• gk449529
• gk313761
• gk721816
• gk778385
• gk728731
• gk621161
• gk839080
• gk475884
• gk429896
• gk478704
• WBVar01880092
• gk681961
• gk686411
• gk935817
• gk281322
• WBVar01880091
• WBVar01980729
• gk281328
• gk430180
• gk281327
• gk301
• gk505701
• gk281326

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00004788
• Start: 5778875
• End: 5780722
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

146 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Expression Pattern Group C, enriched for genes involved in metabolic processes.	The significance (P 0.0001) of the relative age (time) was used to determine if a gene was differentially expressed between the three age (time) groups. The effect of this factor explaining gene expression differences was used to determine if the expression went up or down during the two age/time periods (t1 - t2 and t2 -t3). Authors used a permutation approach to determine the thresholds for the different mapping strategies. For each of the used models for eQTL mapping, authors used 23,000 permutations. For each permutation, authors randomly picked a spot; each spot could only be picked once. The gene expression and relative lifespan values were than randomly distributed over the RILs (and time points) and used for mapping. In this way, authors obtained a threshold for each of the explaining factors. For the single time points, authors used a FDR of 0.01 to adjust for multiple testing. The genome-wide threshold for this FDR is -log10 P = 3.8 for each of the three time points. For the combined models (t1 to t2 and t2 to t3), authors used a genome-wide threshold of -log10 P = 4, which resembles an FDR of 0.006, 0.001, and 0.006 for marker, age, and the interaction between marker and age, respectively. To determine the threshold for the single gene examples, authors used 1000 permutations as in the genome-wide threshold. The difference is that they use the gene under study in all of the permutations. The P-values for the gene specific thresholds were determined at FDR = 0.05.	WBPaper00036286:Pattern_C
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_downregulated
	Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:Cisplatin_downregulated_WT
	Proteins that showed significantly decreased expression in 1-day-old sek-1(km4) adults comparing to in wild type animals, both with 6 hours of cisplatin treatment.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:sek-1(km4)_downregulated_cisplatin
Bacteria: B.thuringiensis	Transcripts in N2 animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407.	Cuffdiff	WBPaper00060358:B.thuringiensis_pathogen_regulated_N2

12 Expression Patterns

• Primary Identifier: Expr5590
• Remark: Strain: BC10004
• Reporter Gene: [sft-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGTTTCCGTTAATGCTGAATG] 3' and primer B 5' [CCCGGAACTGGTTGATTTT] 3'.
• Pattern: Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; vulval muscle; body wall muscle; hypodermis; excretory cell; unidentified cells; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; excretory cell; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr2034022
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr3295
• Pattern: Expressed in body wall muscle, hypodermis, intestine, neurons, pharyngeal muscle and vulva.

• Primary Identifier: Expr1032375
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr13634
• Pattern: GFP-SFT-4 was strongly expressed in the intestine, body wall muscle, and spermatheca. In intestinal cells, GFP-SFT-4 predominantly localizes at ER exit sites (ERES).

• Primary Identifier: Expr13635
• Pattern: Anti-SFT-4 antibody staining of endogenous SFT-4 exhibited a similar pattern as the reporter gene fusion (Expr13634) in the intestine, body wall muscle, and spermatheca. SFT-4 predominantly localizes at ER exit sites (ERES) in intestinal cells.

• Primary Identifier: Expr13116
• Pattern: Refers to NEXTDB In-situ hybridization pattern in the adult gonad.

• Primary Identifier: Expr11777
• Subcellular Localization: An sft-4::gfp translational reporter showed expression in the VPCs in perinuclear structures that resemble the ER.

• Primary Identifier: Expr2015789
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1025924
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram1649
• Remark: Original chronogram file: chronogram.531.xml
• Reporter Gene: [C54H2.5:gfp] transcriptional fusion.

• Primary Identifier: Expr1147174
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

18 GO Annotation

7 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00004788
• Start: 5778875
• End: 5780722
• Strand: -1

18 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1848

1 Sequence Ontology Term