WormMine: Gene WBGene00004910

• WormBase Gene ID: WBGene00004910
• Gene Name: snf-11
• Sequence Name: T03F7.1
• Brief Description: snf-11 encodes an electrogenic, Na[+]/Cl[-]-coupled, high-affinity GABA transporter that is required in vivo for GABA uptake, and for normal aldicarb sensitivity; SNF-11 is orthologous to human SLC6A1 (OMIM:137165); SNF-11 is selective for GABA with a Kt of ~15 microM, has an EC50 value of 168 microM, is blocked by GAT1 inhibitor SKF89976A, and has a 2:1:1 stoichiometry of Na[+]:Cl[-]:GABA; SNF-11 is expressed in several GABAergic neurons, in some other non-GABAergic neurons of the head and retrovesicular ganglion (e.g., RID), and in muscle cells; snf-11(ok156) null mutants fail to show GABA uptake in at least some GABAergic cells, and in cell culture; snf-11(ok156) mutants exhibit GABA-dependent aldicarb resistance, and show abnormal head foraging and defecation in a genetically sensitized background (GABA-transport dependent, with an unc-25 null allele); while unsensitized snf-11(ok156) mutants have grossly normal phenotype, cell cultures from snf-11(ok156) embryos completely lack normal GABA uptake.
• Organism: Caenorhabditis elegans
• Automated Description: Enables gamma-aminobutyric acid:sodium:chloride symporter activity. Involved in gamma-aminobutyric acid transport. Located in neuron projection and neuronal cell body. Expressed in several structures, including GLR; enteric muscle; head mesodermal cell; neurons; and ventral nerve cord. Human ortholog(s) of this gene implicated in alcohol dependence; myoclonic-atonic epilepsy; and temporal lobe epilepsy. Is an ortholog of human SLC6A1 (solute carrier family 6 member 1).
• Biotype: SO:0001217
• Genetic Position: V :3.07267 ±0.000861
• Length (nt): 3377

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00004910

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:T03F7.1.1	T03F7.1.1	2123	V: 11305070-11308446

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:T03F7.1	T03F7.1	1833	V: 11305354-11305452

1 RNAi Result

• WBRNAi00052295

59 Allele

• gk963271
• gk963301
• gk964451
• gk964452
• gk417654
• h4782
• gk896259
• gk698275
• gk384105
• gk854476
• gk522479
• gk366481
• gk619248
• gk890720
• gk541327
• gk824451
• gk402941
• gk933348
• gk572222
• gk511306
• gk626243
• gk653896
• gk823974
• gk430544
• gk576796
• gk583985
• gk728124
• gk433109
• gk817036
• gk847976

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00004910
• Start: 11305070
• End: 11308446
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrV_11304980..11305069
• Length (nt): 90
• Chromosome Location: V: 11304980-11305069
• Organism: Caenorhabditis elegans

202 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Genes that are significantly up regulated in tdp-1(ok803) poly(A) RNA-seq verses in N2.	DESeq v1.14, with cut-off p-value < 0.05 and FDR < 0.1.	WBPaper00046012:tdp-1(ok803)_upregulated
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684)	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
	Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2.	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_N2-background
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2.	DESeq 2, fold change > 2, FDR < 0.05.	WBPaper00065581:hpk-1(pk1393)_upregulated
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in npr-15(tm12539) comparing to in N2 at L4 larva stage.	Fold change > 2, FDR < 0.05.	WBPaper00066608:npr-15(tm12539)_upregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated

10 Expression Patterns

• Primary Identifier: Expr4376
• Remark: Picture: Fig. 7.
• Pattern: ceGAT-1 is expressed in all of the GABA-ergic neurons. These GFP-positive neurons include the VD and DD neurons in the ventral cord, the RMED, RMEV, RMEL, RMER, AVL, and RIS neurons in the head area and the DVB neuron in the tail region. There are two additional GFP-positive neurons in the tail region. These two neurons are PVQR and PVQL. The identity of these GFP-positive neurons were confirmed by epifluorescence microscopy and by the location of the neurons as revealed by a combination of Nomarski-differential interference contrast microscopic observation and 4',6-diamidino-2-phenylindole nuclei-staining method. This expression pattern is evident from the early larva stage through the adult stage. An identical expression pattern was observed with at least 10 transgenic animals.

• Primary Identifier: Expr2034179
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6581
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15693
• Reporter Gene: [snf-11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTGGCAAAGAAGAATGGAGA] 3' and primer B 5' [TGTAGTGGCAGATGAAAGTGCT] 3'.
• Pattern: Adult Expression: body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; Larval Expression: body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons

• Primary Identifier: Expr7836
• Remark: In snf-11(ok156) mutants, anti-SNF-11 staining was completely absent, confirming the specificity of the staining. Picture: Fig 4.
• Pattern: In healthy young adults, the anti-SNF-11 antibody strongly stained the four RME neurons (RMED, RMEV, RMEL, and RMER). Faint staining of three additional GABAergic neurons (AVL, DVB, and RIS) was sometimes observed. Several non-GABAergic neurons, including RID, also seemed to stain. The ventral nerve cord DD and VD inhibitory motor neurons did not stain. Faint staining of the body wall, anal, and uterine muscles with the anti-SNF-11 antibody was observed in some animals.
• Subcellular Localization: Staining of both the processes and the soma of each neuron were observed. In RMED and RMEV, a punctate staining pattern was observed in the posteriorly directed processes, possibly corresponding to synapses.

• Primary Identifier: Expr7837
• Remark: Picture: Figure 5 and Table 1.
• Pattern: These Psnf-11::GFP fusions are expressed in the same neurons (RMEs, AVL, DVB, RIS, and RID) that stained with the anti-SNF-11 polyclonal antibodies. Expression was also noted in two additional neurons near the pharynx as well as two neurons in the retrovesicular ganglion. There were no apparent differences in expression between the two reporters, suggesting that the 1.9-kb region is sufficient to drive expression in all snf-11 positive cells. In contrast to observations reported previously (Jiang et al., 2005 blue right-pointing triangle), authors did not observe snf-11 expression in the ventral cord inhibitory (DD and VD) motor neurons. However, they did observe robust expression in the body wall, anal, and uterine muscles that was not noted previously. In young animals, expression of the Psnf-11::GFP reporter in muscle cells is the most prominent aspect of the expression pattern.

• Primary Identifier: Expr13160

• Primary Identifier: Expr1032440
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1155929
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2015944
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1018656
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

13 GO Annotation

6 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00004910
• Start: 11305070
• End: 11308446
• Strand: -1

13 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 3377

1 Sequence Ontology Term