WormMine: Gene WBGene00006541

• WormBase Gene ID: WBGene00006541
• Gene Name: tbh-1
• Sequence Name: H13N06.6
• Brief Description: tbh-1 encodes a tyramine beta-hydroxylase orthologous to human DBH (OMIM:609312, mutated in dopamine beta-hydroxylase deficiency); TBH-1 activity is required for biosynthesis of the octopamine neurotransmitter.
• Organism: Caenorhabditis elegans
• Automated Description: Enables tyramine-beta hydroxylase activity. Involved in octopamine biosynthetic process. Located in synapse. Expressed in RICL; RICR; and gonad. Human ortholog(s) of this gene implicated in several diseases, including alcohol use disorder; attention deficit hyperactivity disorder; and dopamine beta-hydroxylase deficiency. Is an ortholog of human DBH (dopamine beta-hydroxylase).
• Biotype: SO:0001217
• Genetic Position: X :22.7341 ±0.010816
• Length (nt): 4640

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006541

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:H13N06.6a.1	H13N06.6a.1	1869	X: 15500256-15503396
Transcript:H13N06.6b.1	H13N06.6b.1	2068	X: 15500260-15504522
Transcript:H13N06.6c.1	H13N06.6c.1	2012	X: 15500263-15504895

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:H13N06.6a	H13N06.6a	1758	X: 15500354-15500633
CDS:H13N06.6b	H13N06.6b	1974	X: 15500354-15500633
CDS:H13N06.6c	H13N06.6c	1821	X: 15500354-15500633

2 RNAi Result

• WBRNAi00049396
• WBRNAi00016264

99 Allele

• gk964260
• gk962707
• gk963810
• gk963581
• gk963194
• gk734025
• WBVar01553452
• WBVar01553451
• WBVar01553450
• WBVar01553449
• WBVar01553448
• gk613475
• WBVar01553447
• gk350348
• WBVar01553446
• gk680730
• WBVar01946576
• gk610645
• WBVar01946575
• gk449222
• gk475929
• gk801773
• gk489931
• gk677140
• gk560947
• gk893668
• gk449933
• WBVar02102466
• WBVar01897973
• gk303546

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006541
• Start: 15500256
• End: 15504895
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

253 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in N2 after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_N2
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
Bacteria diet: Escherichia coli HB101. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria E. coli HB101 for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:HB101_downregulated
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly decreased expression in hsp-6(mg585) comparing to in N2 at L4 larva stage.	EdgeR, fold change > 2, FDR < 0.001.	WBPaper00056290:hsp-6(mg585)_downregulated
	Transcripts that showed significantly decreased expression in mdt-15(mg584gf) comparing to in N2 at L4 larva stage.	EdgeR, fold change > 2, FDR < 0.001.	WBPaper00056290:mdt-15(mg584)_downregulated
Dietary restriction	Transcripts that showed significantly decreased expression after N2 animals were under dietary restriction (DR, OP50 OD = 0.1) from 3-day post L4 till 6-day post L4 adult hermaphrodite stage, comparing to under ad libtum (AL, OP50 OD = 3) condition.	Bioconductor package edgeR, p < 0.05.	WBPaper00056443:DietaryRestriction_downregulated
	Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_hrde-1(tm1200)_upregulated
	Transcripts that showed significantly increased expression in animals exposed to 400uM tamoxifen from L1 to L4 larva stage.	DEseq2, fold change > 2	WBPaper00064505:tamoxifen_upregulated
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated

9 Expression Patterns

• Primary Identifier: Expr2035480
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6276
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC12162
• Reporter Gene: [tbh-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCACCCTCTCCTTCTTGATGTT] 3' and primer B 5' [CAACGGCACTTCTGATTTTTC] 3'.
• Pattern: Adult Expression: intestine; rectal gland cells; Reproductive System; spermatheca; gonad sheath cells; Nervous System; head neurons; Larval Expression: intestine; rectal gland cells; Nervous System; head neurons

• Primary Identifier: Expr3721
• Remark: No staining was observed in tbh-1(n3247) mutants.
• Pattern: C. elegans whole-mount staining with TBH-1 antibodies labeled a single pair of head interneurons in the lateral ganglion: these neurons were identified as the RICs. Punctate TBH-1 staining was also observed in the gonadal sheath cells of adult hermaphrodites. TBH-1 staining was most prominent in the proximal three pairs of sheath cells, which form a contractile myoepithelium that expels oocytes from the gonad during ovulation.
• Subcellular Localization: Bright staining was observed in RIC synaptic regions, as indicated by a punctate immunofluorescence pattern in the nerve ring, whereas weaker staining was observed in the RIC neuronal processes and cell bodies. By contrast, TBH-1 staining was predominantly localized to the RIC cell bodies of mutants defective in the unc-104 gene, which encodes a neuron-specific kinesin required for the anterograde transport of synaptic vesicles. TBH-1, like the closely related dopamine B-hydroxylase, probably is associated with synaptic vesicles.

• Primary Identifier: Expr16043
• Pattern: In C. elegans, consistent with a previous report, OA synthetic enzymes are highly expressed in the spermatheca and the proximal gonadal sheath. tbh-1 expression in the gonadal sheath begins from the late larval stage 4 (L4), when diplotene-stage oocytes appear, while tbh-1 expression in RIC interneurons in the head begins as early as at the L1 stage. This tbh-1 expression in gonadal sheath cells accounts for the observation that adult C. elegans produce at least five times more OA than larvae, which express OA only in RIC29. The level of TBH-1 is the strongest in the proximal three pairs of gonadal sheath cells, which cover the meiotic oocytes in- waiting, suggesting a potential OA function in oocyte quiescence. Strong expression in the spermatheca, which are involved in fertilizing and moving the fertilized eggs, suggests a role of OA in ovulation, as has been reported in D. melanogaster.

• Primary Identifier: Expr8276
• Remark: Picture: Supplemental Figure S1.
• Pattern: GFP expression was observed in RIC neurons and gonadal sheath cell.

• Primary Identifier: Expr4165
• Remark: Curated by authors based on online in-situ hybridization database (Y. Kohara, personal communication; http://nematode.lab.nig.ac.jp).
• Pattern: Expressed in somatic gonad.

• Primary Identifier: Expr1153129
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1023515
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2017344
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

19 GO Annotation

9 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006541
• Start: 15500256
• End: 15504895
• Strand: -1

19 Ontology Annotations

2 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in tbh-1(ok1196);odIs77 comparing to in odIs77 control animals.	EdgeR, FDR<0.01	WBPaper00060921:tbh-1(ok1196)_downregulated
	Transcripts that showed significantly increased expression in tbh-1(ok1196);odIs77 comparing to in odIs77 control animals.	EdgeR, FDR<0.01	WBPaper00060921:tbh-1(ok1196)_upregulated

1 Sequence

• Length: 4640

1 Sequence Ontology Term