WormMine: Gene WBGene00006789

• WormBase Gene ID: WBGene00006789
• Gene Name: unc-54
• Sequence Name: F11C3.3
• Brief Description: unc-54 encodes a muscle myosin class II heavy chain (MHC B); UNC-54 is the major myosin heavy chain expressed in C. elegans and is required for locomotion and egg-laying; in vivo and in vitro, UNC-54 interacts with ITR-1, an IP3 receptor, and this interaction may provide a link between calcium signaling and the muscle cytoskeleton; UNC-54 is a thick filament component that is expressed in multiple muscle cell classes including body wall, intestinal, anal depressor, and sphincter muscles as well as sex-specific muscles that develop postembryonically.
• Organism: Caenorhabditis elegans
• Automated Description: Enables actin filament binding activity and microfilament motor activity. A structural constituent of muscle. Involved in several processes, including egg-laying behavior; muscle contraction; and skeletal muscle myosin thick filament assembly. Located in A band and striated muscle myosin thick filament. Part of muscle myosin complex. Expressed in anal depressor muscle; body wall musculature; head; vulval muscle; and in male. Human ortholog(s) of this gene implicated in several diseases, including congenital heart disease (multiple); distal myopathy 1; and intrinsic cardiomyopathy (multiple). Is an ortholog of several human genes including MYH1 (myosin heavy chain 1); MYH2 (myosin heavy chain 2); and MYH3 (myosin heavy chain 3).
• Biotype: SO:0001217
• Genetic Position: I :27.9607 ±0.002243
• Length (nt): 7582

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006789

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F11C3.3.1	F11C3.3.1	6204	I: 14855901-14863482

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F11C3.3	F11C3.3	5892	I: 14856181-14856390

12 RNAi Result

• WBRNAi00061190
• WBRNAi00061193
• WBRNAi00061194
• WBRNAi00000652
• WBRNAi00044368
• WBRNAi00076024
• WBRNAi00091259
• WBRNAi00098725
• WBRNAi00061197
• WBRNAi00061198
• WBRNAi00091258
• WBRNAi00116886

386 Allele

• gk963849
• gk964175
• gk962681
• h10548
• h10549
• otn9417
• otn9418
• gk963947
• gk963269
• gk964059
• gk963714
• gk963713
• r854
• r95
• r109
• r259
• r274
• r293
• r308
• r306
• r310
• r309
• r316
• r315
• r322
• r318
• r325
• r323
• r327
• r342

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006789
• Start: 14855901
• End: 14863482
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_14855828..14855900
• Length (nt): 73
• Chromosome Location: I: 14855828-14855900
• Organism: Caenorhabditis elegans

320 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts enriched in ASG according to single cell RNAseq.	Genes that pass the Bonferroni threshold for multiple comparisons (q < 0.05) are significantly enriched.	WBPaper00061651:ASG_enriched
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
Heat shock: 35C for 1 hour.	Transcripts that showed significantly increased expression immediately after 1-day post L4 adult hermaphrodite endu-2(tm4977) animals were exposed to 35C for 1 hour.	The DESeq2 (GalaxyVersion 2.11.40.6 + galaxy1) was used to determine differentiallyexpressed features from count tables of differential transcript abundances. log2FC > 1, FDR < 0.01.	WBPaper00065749:Heat-Shock_upregulated_endu-2(tm4977)
Heat shock: 35C for 1 hour.	Transcripts that showed significantly increased expression immediately after 1-day post L4 adult hermaphrodite N2 animals were exposed to 35C for 1 hour.	The DESeq2 (GalaxyVersion 2.11.40.6 + galaxy1) was used to determine differentiallyexpressed features from count tables of differential transcript abundances. log2FC > 1, FDR < 0.01.	WBPaper00065749:Heat-Shock_upregulated_N2
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
mitochondrial sulfide delivery molecule (mtH2S) AP39	Transcripts that showed significantly increased expression in N2 animals treated with mitochondrial sulfide delivery molecule (mtH2S) AP39 starting from 1-day-post L4 until 11 days post L4.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:mtH2S-AP39-D0-treatment_upregulated_Day11
	Genes up regulated in alg-1(gk214) comparing to in N2.	Differential expression was assessed using an empirical Bayes statistics using the eBayes function.	WBPaper00040823:alg-1(gk214)_upregulated
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
mitochondrial sulfide delivery molecule (mtH2S) AP39	Transcripts that showed significantly increased expression in N2 animals treated with mitochondrial sulfide delivery molecule (mtH2S) AP39 starting from L1 larva until 11-days-post-L4 adult.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:mtH2S-AP39-L1-treatment_upregulated_Day11
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade).	Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118.	WBPaper00040858:eQTL_regulated_reproductive
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Dietary restriction	Transcripts that showed significantly decreased expression after N2 animals were under dietary restriction (DR, OP50 OD = 0.1) from 3-day post L4 till 6-day post L4 adult hermaphrodite stage, comparing to under ad libtum (AL, OP50 OD = 3) condition.	Bioconductor package edgeR, p < 0.05.	WBPaper00056443:DietaryRestriction_downregulated
	Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684)	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background

15 Expression Patterns

• Primary Identifier: Expr5737
• Remark: Strain: BC10095
• Reporter Gene: [unc-54::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCTTTGCACTTCCTCTGCT] 3' and primer B 5' [GCTCGATGATTTCTCGCTTC] 3'.
• Pattern: Adult Expression: body wall muscle; Nervous System; unidentified cells in head; Larval Expression: body wall muscle

• Primary Identifier: Expr2036023
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1032860
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr732
• Remark: See Expr747 for in situ data. This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: Antibody staining is detected in the anal depressor, and sphincter and intestinal muscles and in the contractile sheath in proximal region of the somatic gonad. Staining is also observed in the vulval muscle cells and neighbouring body wall muscle cells. In addition, staining is observed in the adult male sex muscles along the lateral and ventral surfaces.

• Primary Identifier: Expr16474
• Pattern: gld-1::mScarlet is expressed in the pachytene region of germline. unc-54::mEos3.2 expressed in body wall muscle.

• Primary Identifier: Expr11395
• Remark: Feature : "unc-54.90-mer"
• Pattern: A 90-bp segment of unc-54 functions as a body muscle specific transcriptional enhancer.

• Primary Identifier: Expr571
• Remark: No maternal RNA.
• Pattern: Staining in body muscle cells at bean through pretzel stages.

• Primary Identifier: Expr735
• Remark: This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: 7.5 kb mRNA transcript present in mixed stage embryos, L1 (intense staining) and in L4 larvae. Strong staining at all three stages. Dot blots of total nematode RNA from L2 and L4 larvae. Intense staining in L2 and L4. Immunoblots of nematode homogenates from L1 and L4 larvae. Reaction with specific mouse antibody 28.2 for detection of myosin heavy chain B (unc-54) localized in body wall muscles with exception of a few minor muscles.

• Primary Identifier: Expr747
• Remark: This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: Postembryonic expression, with antisense probe staining is punctate patchy in body wall muscle cells.

• Primary Identifier: Expr1145
• Pattern: Subcellular localization was studied in body wall muscle.
• Subcellular Localization: The antimyosin B antibody 28.2 labels the peripheral portions of the A band but not the medial region. Identical results were obtained with antibodies 5-8 and 5-22.

• Primary Identifier: Expr1025092
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2017887
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1148311
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram1695
• Remark: Original chronogram file: chronogram.615.xml
• Reporter Gene: [F11C3.3:gfp] transcriptional fusion.

• Primary Identifier: Expr3837
• Subcellular Localization: GFP::UNC-54 localizes to myofilaments of body wall muscles

29 GO Annotation

41 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006789
• Start: 14855901
• End: 14863482
• Strand: -1

29 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 7582

1 Sequence Ontology Term