WormMine: Gene WBGene00010700

• WormBase Gene ID: WBGene00010700
• Gene Name: nipi-3
• Sequence Name: K09A9.1
• Brief Description: nipi-3 encodes a kinase similar to the human kinase Tribbles homolog 1; nipi-3 functions in the innate immune response, likely upstream of the SEK-1 MAPKK, to upregulate expression of NLP-29, an antimicrobial peptide, in response to fungal infection.
• Organism: Caenorhabditis elegans
• Automated Description: Enables DNA-binding transcription factor binding activity. Involved in defense response to other organism and regulation of gene expression. Predicted to be located in nucleus. Expressed in CAN; hypodermis; motor neurons; pharynx; and touch receptor neurons. Is an ortholog of human TRIB1 (tribbles pseudokinase 1).
• Biotype: SO:0001217
• Genetic Position: X :22.9309 ±0.001583
• Length (nt): 2655

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00010700

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:K09A9.1.1	K09A9.1.1	2375	X: 15607969-15610623

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:K09A9.1	K09A9.1	1968	X: 15607972-15608553

27 RNAi Result

• WBRNAi00050364
• WBRNAi00099816
• WBRNAi00100447
• WBRNAi00068661
• WBRNAi00068660
• WBRNAi00068663
• WBRNAi00068662
• WBRNAi00068664
• WBRNAi00069040
• WBRNAi00016863
• WBRNAi00025924
• WBRNAi00071880
• WBRNAi00100821
• WBRNAi00099210
• WBRNAi00071642
• WBRNAi00099614
• WBRNAi00099412
• WBRNAi00087266
• WBRNAi00064494
• WBRNAi00025925
• WBRNAi00027412
• WBRNAi00100073
• WBRNAi00100260
• WBRNAi00100634
• WBRNAi00101008
• WBRNAi00111741
• WBRNAi00110875

47 Allele

• gk964260
• gk962707
• gk963810
• gk964354
• gk963581
• gk303802
• gk303803
• gk303800
• gk303801
• gk303806
• gk303804
• gk303805
• gk303807
• gk303808
• WBVar01760808
• WBVar01760809
• WBVar01826071
• fr4
• tm3373
• WBVar00086653
• WBVar01553582
• h16582
• WBVar01901861
• WBVar01901862
• fr148
• ju1293
• fr152
• gk392952
• gk916076
• gk598989

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00010700
• Start: 15607969
• End: 15610623
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_15610624..15611765
• Length (nt): 1142
• Chromosome Location: X: 15610624-15611765
• Organism: Caenorhabditis elegans

208 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA.	Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference.	WBPaper00045974:NSM_enriched_totalRNA_RNAseq
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in vulva.	FPKM >= 1.	WBPaper00064122:vulva_transcriptome
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly increased expression in nhr-114(gk849) comparing to wild type animals at L4 larva.	DESeq2 1.26.0, fold change > 2, FDR < 0.05.	WBPaper00064539:nhr-114(gk849)_upregulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Transcripts that showed significantly increased expression in xrep-4(lax137).	DESeq2. Genes were selected if their p value < 0.01.	WBPaper00066062:xrep-4(lax137)_upregulated
	Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:nuo-6(qm200)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_L3-L4-larva_expressed
Bacteria infection: Staphylococcus aureus	mRNAs that showed increased expression 8 hours after hlh-30(tm1978) animals were infected by S. aureus.	DESeq, p <= 0.05	WBPaper00045314:S.aureus-induced_hlh-30(tm1978)
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly decreased expression in eat-2(ad1116) comparing to in N2 at 3-days post L4 adult hermaphrodite animals.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:eat-2(ad1116)_downregulated
	Transcripts that showed significantly increased expression in dpy-21(e428) comparing to in N2 during L3 stage.	DESeq v1.6.3. Fold change > 1.5.	WBPaper00050370:dpy-21(e428)_L3_upregulated
Bacteria: B.thuringiensis	Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point on the non pathogenic strain Bt407 compared to E. coli OP50.	Cuffdiff	WBPaper00060358:B.thuringiensis_non-pathogen_regulated_elt-2(RNAi)

10 Expression Patterns

• Primary Identifier: Expr6374
• Remark: Strain: BC14959
• Reporter Gene: [K09A9.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAGTAACTAGAATCAGGGGTGGG] 3' and primer B 5' [GCACTCCTCGTACAACTGCTC] 3'.
• Pattern: Adult Expression: intestine; spermatheca; Nervous System; head neurons; tail neurons; Larval Expression: intestine; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr13665
• Pattern: GFP expression was observed in the epidermis, intestine and in neurons, consistent with the previously reported expression pattern obtained using transgenic transcriptional reporters.
• Subcellular Localization: GFP::NIPI-3 expression was observed predominantly in the nuclei, with an overall intensity peaking at the L2-L3 stages.

• Primary Identifier: Expr8070
• Remark: Picture: Figures 6A to 6D.
• Pattern: nipi-3 is expressed in the epidermis, as well as in the pharynx and intestine, in a subset of head neurons and motoneurons, and in the PLM and CAN neurons.

• Primary Identifier: Expr12563

• Primary Identifier: Chronogram892
• Remark: Original chronogram file: chronogram.1938.xml
• Reporter Gene: [K09A9.1:gfp] transcriptional fusion.

• Primary Identifier: Expr2032503
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2014263
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1027431
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1034682
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1154069
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

17 GO Annotation

11 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00010700
• Start: 15607969
• End: 15610623
• Strand: 1

17 Ontology Annotations

2 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in nipi-3(fr4) comparing to in N2.	Differentially regulated transcripts were determined by edgeR. For the microarray and NanoString analyses, genes were considered differentially regulated at FDR < 0.05 and log2 (Fold Change) > 1 or < 1.	WBPaper00050515:nipi-3(fr4)_downregulated
	Transcripts that showed significantly increased expression in nipi-3(fr4) comparing to in N2.	Differentially regulated transcripts were determined by edgeR. For the microarray and NanoString analyses, genes were considered differentially regulated at FDR < 0.05 and log2 (Fold Change) > 1 or < 1.	WBPaper00050515:nipi-3(fr4)_upregulated

1 Sequence

• Length: 2655

1 Sequence Ontology Term