WormMine: Gene WBGene00016828

• WormBase Gene ID: WBGene00016828
• Gene Name: sre-52
• Sequence Name: C50E10.5
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to be involved in sensory perception of chemical stimulus. Predicted to be located in membrane. Expressed in PVT.
• Biotype: SO:0001217
• Genetic Position: II :8.3542 ±0.077558
• Length (nt): 2364

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00016828

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C50E10.5.1	C50E10.5.1	1086	II: 12335730-12338093

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C50E10.5	C50E10.5	1086	II: 12335730-12336202

6 RNAi Result

• WBRNAi00042902
• WBRNAi00012216
• WBRNAi00023100
• WBRNAi00023174
• WBRNAi00023686
• WBRNAi00023974

76 Allele

• gk963801
• gk963053
• gk962684
• gk964116
• WBVar02067096
• WBVar02067095
• WBVar01605479
• h15132
• otn14473
• WBVar01936169
• WBVar02074664
• WBVar02076359
• WBVar01983032
• WBVar01383810
• WBVar01383799
• WBVar00106173
• WBVar01400540
• WBVar01835460
• WBVar01835461
• WBVar01836194
• WBVar01949346
• WBVar01394516
• WBVar01960479
• gk577062
• gk520423
• gk796558
• gk853501
• gk942428
• WBVar01414212
• WBVar02052368

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00016828
• Start: 12335730
• End: 12338093
• Strand: 1

3 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_12338094..12339943
• Length (nt): 1850
• Chromosome Location: II: 12338094-12339943
• Organism: Caenorhabditis elegans

27 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C.	DESeq2, fold change > 2, p-value < 0.05.	WBPaper00061753:csr-1(tor159)_upregulated_25C
	Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly decreased expression in eat-2(ad1116) comparing to in N2 at 3-days post L4 adult hermaphrodite animals.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:eat-2(ad1116)_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Rifampicin_downregulated
	Genes with significantly increased expression in eat-2(ad465) treated with 2% DMSO for 72 hours, comparing to in N2 treated with 2% DMSO for 72 hours.	Analysis of gene expression data was carried out with the Affymetrix Transcriptome Analysis Console. Data preprocessing (using RMA normalization) and QC metrics were performed using Affymetrix Expression Console TM and manually inspected afterwards. Expression analysis was carried out for each two pairwise conditions. FDR statistical correction for multiple testing resulted in a slightly lower number of DEGs in most cases. P-value < 0.05 and fold change > 2.0 were used to determine differentially expressed genes.	WBPaper00048989:eat-2(ad465)_upregulated_in-DMSO
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin, 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Rifampicin-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 100uM Psora from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Psora_downregulated
Bacteria infection: Serratia marcesens	Genes up-regulated in animals infected with Serratia marcesens compared to the E. coli OP50 control after 24h of infection.	MAANOVA and BRB-Array-Tools.	WBPaper00030985:Serratia_marcesens_upregulated
	Genes that showed significantly increased expression level in rsr-2(RNAi) animals comparing to in gfp(RNAi) control.	Fold change > 1.2 or < 0.8.	WBPaper00042477:rsr-2(RNAi)_upregulated_TilingArray
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin, 50uM Rifampicin and 100uM Psora from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Rifampicin-Psora_downregulated
	Transcripts that showed significantly increased expression in unc-70(cas983) comparing to in N2 at L1 larva stage.	DESeq2, fold change >= 2, FDR <= 0.05	WBPaper00057041:unc-70(cas983)_upregulated
	Transcripts that showed significantly decreased expression in nfki-1(cer1) animals at L4 larva stage, comparing to in N2 animals.	Differentially expressed genes between wild type and knockouts were explored using DESeq2 R package (v.1.20.0) considering a threshold of adjusted p value < 0.01.	WBPaper00060445:nfki-1(cer1)_downregulated_L4
	Genes that showed significantly increased expression after exposure to adsorbable organic bromine compounds (AOBr) contained in M. aeruginosa batch culture.	Differentially expressed genes (DEGs) were identified with a random variance t-test and a significance analysis of microarrays (SAM) test. Genes were considered statistically significant if their p-value was less than 0.05, the false discovery rate less than 0.3, and the fold change compared to control at least <= 0.67 or >=1.5.	WBPaper00046853:AOBr_M.aeruginosa-batch-culture_upregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin, 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Psora-Allantoin_downregulated
	Coexpression clique No. 211, srj-42-srw-113, on the genome-wide coexpression clique map for the nematode GPL200 platform.	All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform.	WBPaper00061527:srj-42-srw-113
	Transcripts that showed significantly increased expression in nfki-1(cer1) animals at L1 larva stage, comparing to in N2 animals.	Differentially expressed genes between wild type and knockouts were explored using DESeq2 R package (v.1.20.0) considering a threshold of adjusted p value < 0.01.	WBPaper00060445:nfki-1(cer1)_upregulated_L1
	Top 300 transcripts enriched in ABalpapppa, ABarapappa according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:I1_parent
	Transcripts that showed significantly increased expression in spc-1(cas971) comparing to in N2 at L1 larva stage.	DESeq2, fold change >= 2, FDR <= 0.05	WBPaper00057041:spc-1(cas971)_upregulated
	Genes altered by more than 2-Fold in late versus early generation prg-1 mutants and prg-1; daf-2 mutants. Samples include prg-1(pk2290), prg-1(n4357), prg-1(tm872), prg-1(pk2290); daf-2(e1368), prg-1(pk2290); daf-2(e1370), prg-1(tm872); daf-2(e1370), prg-1(tm872); daf-2(m41).	Genes with more than 2-fold change in expression level are considered differentially expressed.	WBPaper00045217:prg-1_progressively_regulated
Reduced humidity (98% relative humidity).	Genes that were up-regulated after one day exposure to reduced humidity (98% relative humidity) according to microarray analysis.	Multiple hypothesis testing with the Benjamini-Hochberg correction was applied on calculated p-values. A change in the expression level was considered to be significant if the adjusted p-value was less than 0.001.	WBPaper00044578:reduced-humidity_upregulated_microarray

6 Expression Patterns

• Primary Identifier: Expr2034531
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr5554
• Remark: Also expressed in (comments from author) : No comments. Strain: BC11973
• Reporter Gene: [sre-52::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAGGCAGGAACAAAAAGTAGCTG] 3' and primer B 5' [TGATTTTGTTACTTAGGGGGAAAA] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr14046
• Pattern: 1-3 head neuron pairs (quite dim and variable), PVT

• Primary Identifier: Expr2016305
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1146874
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1017273
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00016828
• Start: 12335730
• End: 12338093
• Strand: 1

4 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2364

1 Sequence Ontology Term