WormMine: Gene WBGene00019163

• WormBase Gene ID: WBGene00019163
• Gene Name: ubxn-6
• Sequence Name: H06H21.6
• Brief Description: ubxn-6 encodes one of six C. elegans UBX (ubiquitin regulatory X) domain-containing proteins.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to be located in cytoplasm. Expressed in pharynx. Is an ortholog of human UBXN6 (UBX domain protein 6).
• Biotype: SO:0001217
• Genetic Position: IV :1.28692 ±0.004576
• Length (nt): 2072

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00019163

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:H06H21.6.1	H06H21.6.1	1488	IV: 4807426-4809497

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:H06H21.6	H06H21.6	1314	IV: 4807590-4807853

6 RNAi Result

• WBRNAi00049313
• WBRNAi00049314
• WBRNAi00016208
• WBRNAi00033670
• WBRNAi00078147
• WBRNAi00062292

36 Allele

• gk964500
• gk963722
• gk963150
• gk963908
• WBVar00188803
• WBVar00188804
• gk200887
• gk200888
• gk200889
• gk200885
• gk200886
• gk956675
• gk470835
• gk542464
• gk432684
• gk331002
• gk912317
• gk853638
• gk847809
• gk853639
• gk439189
• gk387461
• gk885436
• gk866845
• gk385512
• gk717450
• gk658510
• gk533442
• gk331382
• gk729566

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00019163
• Start: 4807426
• End: 4809497
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_4807320..4807425
• Length (nt): 106
• Chromosome Location: IV: 4807320-4807425
• Organism: Caenorhabditis elegans

96 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade).	Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118.	WBPaper00040858:eQTL_regulated_reproductive
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
Bacteria diet: Escherichia coli HB101. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria E. coli HB101 for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:HB101_downregulated
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
25C vs. 20C	Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:25C_vs_20C_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain.	RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis.	WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Transcripts that showed altered expression from P0 to F2 generation animals after N2 parental generation were treated with antimycin, but not in damt-1(gk961032) P0 to F2 animals after the parenal generaton were treated with antimycin.	N.A.	WBPaper00055862:antimycin_damt-1(gk961032)_regulated
	Proteins identified in extracellular vesicle.	N.A.	WBPaper00062669:extracellular-vesicle_protein
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated
	Transcripts that showed decreased expression in hlh-11(ko1) knockout strain comparing to in wild type background.	DESeq2, FDR < 0.05	WBPaper00060683:hlh-11(ko1)_downregulated
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_downregulated

8 Expression Patterns

• Primary Identifier: Expr2035873
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr4677
• Pattern: The expression of UBXN-6::GFP was very weak. UBXN-6::GFP was expressed only in pharynx and several nerve cells in head of adult but not in embryos.

• Primary Identifier: Expr4671
• Pattern: The transcriptional patterns of ubxn-6 was also very similar to those of ubxn-1, -3, and -4 (see Expr4667, Expr4668 and Expr4669), although the amount of ubxn-6 mRNA at embryonic stage was relatively low.

• Primary Identifier: Expr6273
• Remark: Strain: BC15510
• Reporter Gene: [H06H21.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGTGTTCGTTTGTCATCCG] 3' and primer B 5' [CTCTCTCCACCTGCATCTCC] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; Larval Expression: Nervous System; head neurons

• Primary Identifier: Expr1153059
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1038275
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1025316
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2017734
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

3 GO Annotation

5 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00019163
• Start: 4807426
• End: 4809497
• Strand: -1

3 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2072

1 Sequence Ontology Term