WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00016224 Gene Name  fbxa-57
Sequence Name  ? C29F9.10 Organism  Caenorhabditis elegans
Automated Description  Is affected by several genes including cyc-1; mut-2; and etr-1 based on microarray; tiling array; and RNA-seq studies. Is affected by nine chemicals including tryptophan; Psoralens; and allantoin based on microarray and RNA-seq studies. Biotype  SO:0000336
Genetic Position  III :-26.985± Length (nt)  ? 1076
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00016224

Genomics

0 Transcripts

 

Other

0 CDSs

0 RNAi Result

76 Allele

Public Name
gk962532
gk964281
WBVar02122373
WBVar02124464
WBVar01697945
WBVar01697946
WBVar01697947
WBVar01697948
WBVar01697949
WBVar01697954
WBVar01697950
WBVar01697951
WBVar01697952
WBVar01697953
WBVar02121864
WBVar02120971
WBVar02123215
WBVar02123376
WBVar02122931
WBVar02121400
WBVar02123897
WBVar02123035
WBVar02121153
WBVar02122115
WBVar01655580
gk963331
gk963789
WBVar02070739
WBVar02073958
WBVar01767954

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00016224 106824 107899 -1

2 Data Sets

Name URL
WormBaseAcedbConverter  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_98923..106823   7901 III: 98923-106823 Caenorhabditis elegans

67 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Genes up regulated by Tryptophan. Differentially expressed genes had a fold change cutoff of 2.0 and an unpaired t test p value cutoff of 0.05 for WT+Trp versus WT and 0.01 for nhr-114 versus glp-1. WBPaper00042194:Tryptophan_upregulated
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
  Genes that were upregulated in lin-15B(n744). For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis. WBPaper00038168:lin-15B(n744)_upregulated
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
  Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2. To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. WBPaper00047131:daf-2(e1370)_upregulated_N2-background
  Transcripts that showed significantly decreased expression in daf-16(mgDf50) comparing to in N2 at L1 larva stage. DESeq v1.20.0 was used to analyze differential gene expression. Transcripts with adjusted p-value < 0.05 were considered differentialled expressed. WBPaper00048971:daf-16(mgDf50)_downregulated_L1
  Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066594:ilc-17.1(syb5296)_upregulated
  Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. WBPaper00062159:hda-2(ok1479)_upregulated
  Transcripts that showed significantly decreased expression in eat-2(ad1116) comparing to in N2 at 3-days post L4 adult hermaphrodite animals. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:eat-2(ad1116)_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Psora-Allantoin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Psora_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Allantoin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Metformin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50uM Rifampicin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Rifampicin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin-Allantoin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin_downregulated
Bacteria: B.thuringiensis Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407. Cuffdiff WBPaper00060358:B.thuringiensis_pathogen_regulated_elt-2(RNAi)
Bacteria: B.thuringiensis Transcripts in N2 animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407. Cuffdiff WBPaper00060358:B.thuringiensis_pathogen_regulated_N2
  Up-regulated genes (fold change > 1.5) in two CoQ-deficient clk-1 mutant strains (e2519, qm30) compared to wild types N2. Fold-changes of intensities were calculated from the arithmetic mean of gene expression values between experimental and corresponding control group. Fold change >= 1.5 was used as cut-off. WBPaper00045774:clk-1_upregulated
  Genes expressed in N2. Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0. WBPaper00025141:N2_Expressed_Genes
  Transcripts unqiuely expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_enriched
  Transcripts that showed significantly increased expression in zip-3(gk3164) comparing to in N2, after exposed to P. aeruginosa for 18 hours. p < 0.05 WBPaper00056326:zip-3(gk3164)_upregulated_P.aeruginosa-infected
hypergravitational 15xg force for 4 days via centrifugation. Transcripts that showed significantly decreased expression in animals grew under the hypergravitational 15xg force for 4 days via centrifugation. N.A. WBPaper00061274:hypergravity_15xg_downregulated
Oxidative stress. Genes upregulated by oxidative stress. Assessed by SAM (Significance Analysis of Microarray) [false discovery rate (FDR) = 11%] WBPaper00034757:up_by_oxidative_stress
  Genes with significant increase of expression in UPF1 smg-2(RNAi) comparing to control. Bioconductor package LIMMA was used to determine differentially expressed genes. The P-values were adjusted for multiple testing with a false-discovery rate (50). Probe sets with fold-change > 1.5 and q-value < 0.05 were used as a cut-off for C. elegans microarrays WBPaper00042561:smg-2(RNAi)_upregulated
Bacteria infection: Pseudomonas aeruginosa PA14. 24 hours of exposure at 25C. Transcripts that showed significantly decreased expression in N2 animals with 24 hours of exposure to P. aeruginosa PA14 for 24 hrs at 25C, comparing to N2 animals without exposure to PA14. DESeq2, fold change > 2, FDR < 0.05. WBPaper00058948:PA14_downregulated
  Transcripts that showed significantly decreased expression in hsf-1(RNAi) animals comparing to in control animals, without heat shock. Transcripts that were differentially expressed in different conditions, compared to the hsf-1(+);-HS control, were determined with CuffDiff, which uses the Benjamini-Hochberg correction for multiple testing to obtain the q-value (the FDR-adjusted the p-value). WBPaper00049942:hsf-1(RNAi)_downregulated

4 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC15667 [C29F9.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCCGCGATTTTGTAATTTTTAAT] 3' and primer B 5' [TTAATGCAATATGAGCATTTCAGA] 3'. Expr5378 Adult Expression: Nervous System; pharyngeal neurons; Larval Expression: intestine; Nervous System; pharyngeal neurons;  
    Expr1019662 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Original chronogram file: chronogram.1871.xml [C29F9.10:gfp] transcriptional fusion. Chronogram830    
    Expr1145515 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

0 GO Annotation

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00016224 106824 107899 -1

0 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

Length
1076

1 Sequence Ontology Term