WormMine: AnatomyTerm WBbt:0006789

• Definition: membranous cell attaches the uterus to the lateral epidermis (seam) and forms a thin laminar process dorsal to the vulva. formed by fusion of eight pi cell progeny and AC.
• Name: uterine seam cell
• Primary Identifier: WBbt:0006789
• Synonym: utse

2 Children

Definition	Name	Synonym	Primary Identifier
utse whose nuclei followed lineage configuration 5R in development.	uterine seam cell 5R	utse 5R	WBbt:0008220
utse whose nuclei followed lineage configuration 5L in development.	uterine seam cell 5L	utse 5L	WBbt:0008219

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Single-cell RNA-Seq cell group 11_3 expressed in seam.	scVI 0.6.0	WBPaper00065841:11_3
	Single-cell RNA-Seq cell group 68 expressed in: Uterine seam cells.	CellRanger, DecontX, Monocle3, Louvain algorithm.	WBPaper00065623:68

53 Expression Patterns

• Primary Identifier: Expr4733
• Remark: rrc-1 = yk273h6
• Pattern: GFP expression was detected in the coelomocytes, excretory cell, and uterine-seam cell. GFP signals were also detected in a bilateral pair of cells near posterior isthmus of pharynx. These cells were identified as GLRL and GLRR based on their positions and characteristic morphology. Relatively weak expression was seen in developing embryos.

• Primary Identifier: Expr4980
• Remark: Picture: Fig 4B. Similar expression patterns were observed for a variety of different transgenic alleles, carrying both extrachromosomal and integrated arrays.
• Pattern: In all larval stages, BRO-1::GFP is expressed in H0 to 2, V1 to 6 and T seam progeny. Faint expression is also observed in hypodermal nuclei, some of which are embryonically derived and which are not therefore simply anterior daughters of the L1 stem cell division containing a perdurance of GFP expression. Expression of BRO-1::GFP was also seen in the uterine seam (utse) during late L4 in hermaphrodites.
• Subcellular Localization: BRO-1::GFP is localised to both the cytoplasm and nucleus.

• Primary Identifier: Expr4981
• Remark: Picture: Fig. 4D, 4E.
• Pattern: BRO-1 and RNT-1 are co-expressed in seam and muscle cells, and BRO-1 is additionally expressed in hypodermal nuclei, certain pharyngeal neurons and the utse.
• Subcellular Localization: Co-localisation is shown using rescuing bro-1::DsRed (pAW303) and rnt-1::GFP (pAW260) constructs. Faint BRO-1::RFP and RNT-1::GFP co-localisation is also observed in certain body wall muscle cells. BRO-1::RFP, but not RNT-1::GFP, was observed in certain pharyngeal neurons.

• Primary Identifier: Expr4976
• Remark: Picture: Figure 4A and supplemental Table S1.
• Pattern: OCR-2 reporter expression was found in sensory neurons. These sensory neurons have no known role in egg laying. In addition, OCR-2 reporter was expressed in cells of the egg-laying system. These were the four uterus-associated uv1 cells attached to the ventral surface of the uterus, as well as the syncytial uv1-associated cell utse. In adults, OCR-2 reporter expression was much stronger in uv1 than in utse; in larval animals, it was the reverse.

• Primary Identifier: Expr4977
• Remark: Picture: Fig. 1C.
• Pattern: Following the specification event at the late L3 stage and just prior to division at L3 lethargus, fluorescence from an egl-13::GFP transcriptional reporter (pWH17) was initiated in pi nuclei. Expression of this reporter, persisted through division, differentiation, and morphogenesis.

• Primary Identifier: Expr4654
• Remark: Since utse aff-1 expression and AC-utse fusion occur almost simultaneously, it is possible that aff-1 expression detected in the utse is actually a contribution from the AC cytoplasm after the fusion event. To test this, authors examined utse aff-1 expression in lin-29(n482) mutant worms where AC-utse fusion does not occur. aff-1 expression in the utse in these mutants indicated that aff-1 is specifically expressed in the utse cells and is not a consequence of AC to utse cytoplasmic GFP diffusion after fusion.
• Pattern: Specific and continuous expression was detected in the AC from the invasion of the vulval primordium at mid-L3 until its fusion with the utse cells. As the vulva completes its invagination in the L4, the utse syncytium starts to express aff-1, resulting in coexpression of aff-1 in both cells prior to their fusion. Thus, AFF-1 is dynamically expressed in a specific group of cells that undergo cell fusion during normal development. aff-1 expression is first detected in the embryonic hyp5 cell and later during larval development in various cell types, including pharyngeal muscles (Pm3 and Pm5), uterine rings (Ut2 and Ut4), head and tail neurons, sheath cells of chemosensory neurons, and male tail neurons). aff-1 is also expressed in vulval vulD and the seam cells shortly before these cells fuse. In general, the myoepithelial cells of the pharynx and the epithelial cells in the uterus, vulva, and hypodermis that express aff-1 undergo fusion. Thus, AFF-1 is dynamically expressed in a specific group of cells that undergo cell fusion during normal development.

• Primary Identifier: Expr5203
• Remark: Also expressed in (comments from author) : Pharynx expression is the MARGINAL CELLS (Hall Lab, 2005).unidentified cells in tail and head head is possibly neural, low intensity GFP. Strain: BC12754
• Reporter Gene: [C07H6.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTGGAATTGAGTTGGCACTCT] 3' and primer B 5' [GTTGGTGTCGATCAGGTGG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; Reproductive System; uterus; uterine-seam cell; vulva other; spermatheca; Nervous System; nerve ring; ventral nerve cord; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; uterine-seam cell; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5383
• Remark: Strain: DM12665
• Reporter Gene: [C30F12.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCCCACGTGTGCAATGTT] 3' and primer B 5' [ATCGATCTTGAAATTTTGTGGTTT] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; uterine-seam cell; gonad sheath cells; Nervous System; head neurons; amphids; tail neurons; phasmids; Larval Expression: pharynx; intestine; Reproductive System; gonad sheath cells; Nervous System; head neurons; amphids; tail neurons; phasmids

• Primary Identifier: Expr5385
• Remark: Also expressed in (comments from author) : Possibly seeing arcade cells. Strain: BC12665
• Reporter Gene: [C30F12.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCCCACGTGTGCAATGTT] 3' and primer B 5' [ATCGATCTTGAAATTTTGTGGTTT] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal gland cells; Reproductive System; uterine-seam cell; vulva other; gonad sheath cells; Nervous System; head neurons; amphids; tail neurons; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharynx; intestine; rectal gland cells; Reproductive System; developing vulva; uterine-seam cell; gonad sheath cells; Nervous System; head neurons; amphids; tail neurons; unidentified cells in body ;unidentified cells in tail

• Primary Identifier: Expr5064
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC14242
• Reporter Gene: [B0403.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCGTGAAAATTATCAAAACTTCG] 3' and primer B 5' [AGCCATGACGATCCACTAATCT] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; intestine; Reproductive System; uterine-seam cell; excretory gland cells; coelomocytes; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharyngeal gland cells; intestine; excretory gland cells; coelomocytes; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5056
• Remark: Also expressed in (comments from author) : neural in head may be the Labial Sensilla. Strain shows high intensity GFP, therefore anything neural can be hard to see. Strain: BC10655
• Reporter Gene: [B0336.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATATCAATGAAAACGGTCAATGG] 3' and primer B 5' [ATTGTCGATGTGGATGCTTTC] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; anal sphincter; Reproductive System; uterine-seam cell; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; labial sensilla; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; anal sphincter; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; labial sensilla; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5042
• Remark: Strain: BC14636
• Reporter Gene: [ckb-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGTGAAAAGTTTAACTACAAAACTG] 3' and primer B 5' [TTTGGAGAAACAAAATTGTATGG] 3'.
• Pattern: Adult Expression: Reproductive System; uterine-seam cell; excretory gland cells; Larval Expression: pharyngeal gland cells; intestine; Reproductive System; uterine-seam cell; excretory gland cells

• Primary Identifier: Expr5943
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15410
• Reporter Gene: [dog-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATGCCTCTTCAGAGATTTCG] 3' and primer B 5' [TGGATCGCTTGAGGACATAA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; Reproductive System; uterus; spermatheca uterine valve; spermatheca; Nervous System; nerve ring; ventral nerve cord; tail neurons; Larval Expression: pharynx; pharyngeal gland cells; Reproductive System; developing vulva; developing uterus; uterine-seam cell; developing spermatheca; Nervous System; nerve ring; ventral nerve cord; tail neurons

• Primary Identifier: Expr5944
• Remark: Also expressed in (comments from author) : Mosaic population.Hypodermis: only in the tail.Coelomocytes: saw the 4 ventral cells. Strain: BC14222
• Reporter Gene: [F33H2.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACATAATCGATAGACTCCCAGC] 3' and primer B 5' [TAGACGGGATGATTGAGGATG] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; spermatheca; body wall muscle; excretory gland cells; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; Larval Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; anal depressor muscle; anal sphincter; rectal epithelium; Reproductive System; distal tip cell; developing gonad; developing vulva; developing uterus; uterine-seam cell; developing spermatheca; gonad sheath cells; body wall muscle; hypodermis; excretory gland cells; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body

• Primary Identifier: Expr5938
• Remark: Also expressed in (comments from author) : No comments. Strain: BC10403
• Reporter Gene: [F32F2.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTAGTCATGCAAACCTCTAG] 3' and primer B 5' [GATTCGAGGATCTACTTGATGC] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; uterine-seam cell; body wall muscle; excretory cell; Nervous System; ventral nerve cord; head neurons; unidentified cells; Larval Expression: pharynx; intestine; body wall muscle; excretory cell; Nervous System; ventral nerve cord; head neurons; unidentified cells

• Primary Identifier: Expr5916
• Remark: Strain: BC14231
• Reporter Gene: [gsp-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGACAGCTGATTCAATGTTCTTC] 3' and primer B 5' [GTTCGAGATTGTTTTTGCAGC] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal sphincter; Reproductive System; uterine-seam cell; vulval muscle; spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; head neurons; tail neurons; Larval Expression: pharynx; intestine; anal sphincter; Reproductive System; developing vulva; uterine-seam cell; developing spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; head neurons; tail neurons

• Primary Identifier: Expr6604
• Remark: Also expressed in (comments from author) : No comments. Strain: BC16158
• Reporter Gene: [frm-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATGCAGGACTAGGAAAAACTAGA] 3' and primer B 5' [TCCAGGAGATCTGAAAATAACCA] 3'.
• Pattern: Adult Expression: uterine-seam cell; seam cells; Larval Expression: intestine; seam cells; Nervous System; ventral nerve cord

• Primary Identifier: Expr6676
• Remark: Also expressed in (comments from author) : No comments. Strain: BC13422
• Reporter Gene: [nas-22::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGAAGTCGATATTCGAGAGA] 3' and primer B 5' [ACTGTGCTTGCAATTGTGCTT] 3'.
• Pattern: Adult Expression: Reproductive System; uterine-seam cell; Larval Expression: Reproductive System; uterine-seam cell

• Primary Identifier: Expr6730
• Remark: Also expressed in (comments from author) : Mosaic population.Neural head and tail is possibly amphid/phasmid, but masked by pharynx and hypodermis Strain: BC11319
• Reporter Gene: [T21D12.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCACTCGTGACGCATTTG] 3' and primer B 5' [CTGGTGGAAGAGGGATTTTCT] 3'.
• Pattern: Adult Expression: pharynx; intestine; stomato-intestinal muscle; Reproductive System; distal tip cell; uterine-seam cell; vulval muscle; spermatheca; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; amphid socket cells; neurons along body; tail neurons; unidentified cells in body ; Larval Expression: pharynx; intestine; stomato-intestinal muscle; Reproductive System; distal tip cell; developing vulva; developing uterus; developing spermatheca; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; amphid socket cells; neurons along body; tail neurons; unidentified cells in body

• Primary Identifier: Expr6715
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14981
• Reporter Gene: [T19D7.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGCTTGAATGATAGAAAATGGG] 3' and primer B 5' [CAACTCGTTCATGATTTTGGC] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal gland cells; Reproductive System; uterine-seam cell; spermatheca; gonad sheath cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; pharyngeal neurons; tail neurons; Larval Expression: pharynx; intestine; rectal gland cells; Reproductive System; developing gonad; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; pharyngeal neurons; tail neurons

• Primary Identifier: Expr6023
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14238
• Reporter Gene: [F41C3.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCGTTGCTCACAAATATTTTCTC] 3' and primer B 5' [CAGAAGGGTTTTGATACCTGAAAT] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; uterine-seam cell; uterine muscle; body wall muscle; hypodermis; Nervous System; head neurons; unidentified cells in body ; Larval Expression: pharynx; intestine; body wall muscle; hypodermis; Nervous System; head neurons

• Primary Identifier: Expr6964
• Remark: Also expressed in (comments from author) : Mosaic population.Sometimes cell bodies in head, perhaps neural? or arcade? Strain: BC12912
• Reporter Gene: [Y41D4A.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCGAGAAAAACTCTGCAATATCC] 3' and primer B 5' [TACCCGGATGGCTTTGAA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterus; uterine-seam cell; uterine muscle; vulval muscle; body wall muscle; head mesodermal cell; hypodermis; seam cells; coelomocytes; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; intestine; Reproductive System; distal tip cell; developing vulva; developing uterus; body wall muscle; head mesodermal cell; hypodermis; seam cells; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr8908
• Remark: Picture: N.A.
• Pattern: Expressed in marginal cells, pharyngeal glands, rectal glands and utse.

• Primary Identifier: Expr9338
• Pattern: Ags-3::GFP expression was seen in most or all adult neurons, including neurons in the head, tail, egg-laying system, along the ventral and dorsal nerve cords, and in muscles, including body wall muscles, egg-laying muscles, and pharyngeal muscles.

• Primary Identifier: Expr3278
• Pattern: In the embryo, the upstream promoter (ten-1a) is most active in the descendants of the C and EMS blastomers. During postembryonic development, GFP expression was detected in the pharynx, gut, coelomocytes, posterior body wall muscles, vulva muscles in hermaphrodites, and diagonal muscles in males. The ten-1a promoter is also active in some hypodermal cells including the hyp-11 cell, hypodermal seam cells, and rectal hypodermis. In the somatic gonad, it is active throughout its development starting with z1 and z4 cells in the embryo. During gonad development, it is expressed in the distal tip cells and the linker cell in males, in gonad and spermatheca sheath cells, and the utse cells of the uterus. In males, ten-1a is active in the vas deferens and spicule socket cells. Furthermore, GFP expression in DVB neurons and a few ring interneurons could be detected.

• Primary Identifier: Expr13531
• Remark: LET-805::GFP generated with CRISPR- no standard allele name
• Pattern: Wild type LET-805::GFP localized to epidermal hemidesmosomes, from mid-embryogenesis onwards, as expected from prior immunocytochemical studies. Localization was also observed at the pharynx and uterine seam, consistent with previous results, and along touch neuron processes.

• Primary Identifier: Expr7425
• Remark: Clone: pUL#JRH/AA2
• Pattern: Strong expression is seen in approximately 6 head nerve cells from late embryogenesis onwards, although expression by the adult stage is weaker. Also expression is seen in a single cell in the mid body of mid larval stages and onwards that may be the utse cell from its shape. Some weak posterior intestinal expression (probably background artefact) is seen in the adult.

• Primary Identifier: Expr51
• Remark: Fusion junction is at position 21392 in F18G5 ...GTATTCTCTGAGAGAAGGAATGATC/lacZ Young and Hope (1993). Dev. Dynam. 196:124-132 = [cgc1752]. Legacy Data: Author "Arnold JM" "Guo J" "Hope IA"Date 1992-01. life_stage summary : postembryonic
• Pattern: b-galactosidase expression in the spermathecae and the three rectal epithelial cells. Staining in the rectal area was first observed in L1 larvae whilst expression in the spermathecae appeared as the structure formed in L4 larvae. Variable staining was also seen throughout the uterus. In the mature gonad staining appeared to be in the two sets of two large toroidal epithelial cell, Ut-1 and Ut-2. Staining was also observed in the large, multinucleate H-shaped Use cell which attaches the uterus to the seam cells and to the four epithelial cells Ut-1 and Ut-2. The Uv-1 cells did not appear to stain. Individual worms often showed only one component of this expression pattern. In the male, expression was observed to be dispersed in what appeared to be all or part of the proctodeum.

• Primary Identifier: Expr14340
• Pattern: Labeled EXC-2 is located at the lumen of the excretory canal, in the corpus, posterior bulb, and pharyngeal-intestinal valve of the pharynx, as well as in the uterine seam and intestinal-rectal valve.
• Subcellular Localization: Labeled EXC-2 is located apical to canal cytoplasm, as determined via cross-sectional fluorescence intensity measurements. This result was confirmed by evaluating the subcellular location of EXC-2 relative to a known apical membrane protein, ERM-1 (Gbel et al. 2004). The results demonstrate that EXC-2 and ERM-1 show overlapping expression at the canal apical (luminal) membrane.

• Primary Identifier: Expr8679
• Remark: Picture: Fig 3.
• Pattern: Expression in the alimentary canal: Strong and consistent expression in anterior arcades, posterior arcades, pharyngeal epithelium, pm4, pm8, g1, g2, vir, K.a/K' cells. inx-11 is more strongly expressed in the most posterior (int 9) intestinal cell. Weak or rare expression in pm1, pm2, pm3, pm5, pm6, pm7. Expression in the nervous system: CEPsh, DVC, LUA. Expression in the reproductive system: In adult stage, expressed in utse. In developing larva stage, expressed in uterus, sperm (spermatocytes, spermatids). Expression of inx-11 appears in pharyngeal tissue around two-fold stage, and by three-fold stage, strong expression becomes restricted to g1, g2, pm4, and pm8. inx-11 is expressed in the hypodermal cells of the animal in postembryonic stages.

0 Life Stages

4 Parents

Definition	Name	Synonym	Primary Identifier
The organ in which the eggs are developed and protected until laid.	uterus		WBbt:0006760
cell of the epithelia of uterus.	uterine epithelial cell		WBbt:0008435
somatic (not germline) cell of the hermaphrodite gonad.	hermaphrodite somatic gonadal cell		WBbt:0007815
cell that has more than one nucleus.	syncytium	syncitium	WBbt:0008074