WormMine: ExpressionPattern Expr5156

• Pattern: Adult Expression: Reproductive System; vulval muscle; excretory cell; unidentified cells in head; unidentified cells in tail ; Larval Expression: Nervous System; nerve ring; ventral nerve cord; unidentified cells in head; unidentified cells in tail
• Primary Identifier: Expr5156
• Remark: Strain: BC12358
• Reporter Gene: [rgs-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATAGACGTTTTCTTCTCCGTTTTT] 3' and primer B 5' [ATATATCCGATGGGCTGGC] 3'.

8 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
neuron with cell body associated with the ventral nerve cord.	ventral cord neuron	ventral cord motoneuron	WBbt:0005300
muscle associated with hermaphrodite vulva.	vulval muscle		WBbt:0005821
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
H-shaped cell associated with the excretory system, largest cell in C. elegans.	excretory cell	excretory canal cell	WBbt:0005812
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes.	nerve ring	circumpharyngeal nerve ring	WBbt:0006749
posterior region, from rectum to the end	tail		WBbt:0005741
anterior-most body region containing the pharynx.	head		WBbt:0005739
	reproductive system		WBbt:0005747

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00004344	rgs-1	C05B5.7	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023