WormMine: ExpressionPattern Expr5463

• Pattern: Adult Expression: pharynx; Reproductive System; vulva other; gonad sheath cells; body wall muscle; Nervous System; tail neurons; unidentified cells in head; unidentified cells in body ; Larval Expression: body wall muscle; Nervous System; tail neurons; unidentified cells in head; unidentified cells in body
• Primary Identifier: Expr5463
• Remark: Also expressed in (comments from author) : Unidentified cells in head and around vulva. Strain: BC11105
• Reporter Gene: [C37E2.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATCACCGAGTAAAATACGCAA] 3' and primer B 5' [AGGATGCTGAAAACATTGGAGT] 3'.

9 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
female genital.	vulva		WBbt:0006748
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion.	body wall musculature	body muscle	WBbt:0005813
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the tail, posterior to rectum.	tail neuron		WBbt:0006759
five pairs of thin gonadal sheath cells form a single layer covering the germ line component of each arm, each pair occupying a stereotyped position along the gonad proximal-distal axis.	gonadal sheath cell		WBbt:0005828
anterior-most body region containing the pharynx.	head		WBbt:0005739
	reproductive system		WBbt:0005747
region of the body by which tissues, cells or cell parts are classified	body region		WBbt:0005738

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00007993	idhb-1	C37E2.1	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023