WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: rectal epithelium; hypodermis; seam cells; Nervous System; ventral nerve cord; head neurons; tail neurons; Larval Expression: rectal epithelium; Reproductive System; developing vulva; hypodermis; seam cells; Nervous System; ventral nerve cord; head neurons; tail neurons; Primary Identifier  Expr5514
Remark  Also expressed in (comments from author) : No comments. Strain: BC15683 Reporter Gene  [C46C11.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAGCAGTGTTTGCGGAAGG] 3' and primer B 5' [CGTTTCGGGATTGTTTCAGT] 3'.

9 Anatomy Terms

Definition Name Synonym Primary Identifier
neuron with cell body associated with the ventral nerve cord. ventral cord neuron ventral cord motoneuron WBbt:0005300
female genital. vulva   WBbt:0006748
Epidermal layer. hypodermis epidermis WBbt:0005733
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
neuron with its cell body situated in the tail, posterior to rectum. tail neuron   WBbt:0006759
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail seam cell lateral hypodermis WBbt:0005753
epithelium connecting intestine and anus. rectal epithelium   WBbt:0005800
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00016704 hosl-1 C46C11.1 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023