WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; Reproductive System; uterus; body wall muscle; hypodermis; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; body wall muscle; hypodermis; unidentified cells in tail ; Primary Identifier  Expr5624
Remark  Also expressed in (comments from author) : unidentified cells in tail, possibly neural Strain: BC13363 Reporter Gene  [elo-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTCTGCCATTGCAAACAGTC] 3' and primer B 5' [TCGTATTTTGCGATTTTTCTGA] 3'.

8 Anatomy Terms

Definition Name Synonym Primary Identifier
A group of six equivalent cells forms a tightly constructed `valve` that links the posterior bulb of the pharynx to the anterior four cells of the intestine. These six cells comprise a small epithelial channel with a cuticular lining in continuity with the pharyngeal cuticle and link the lumen of the pharynx to the large lumen of the anterior intestine. pharyngeal-intestinal valve cardia WBbt:0005767
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813
Epidermal layer. hypodermis epidermis WBbt:0005733
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
The organ in which the eggs are developed and protected until laid. uterus   WBbt:0006760
posterior region, from rectum to the end tail   WBbt:0005741
  rectal gland cell   WBbt:0005799
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001241 elo-3 D2024.3 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023