WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: rectal epithelium; Reproductive System; vulva other; hypodermis; excretory cell; coelomocytes; Nervous System; head neurons; Larval Expression: rectal epithelium; hypodermis; excretory cell; coelomocytes; Nervous System; head neurons; Primary Identifier  Expr5893
Remark  Also expressed in (comments from author) : No comments. Strain: BC14985 Reporter Gene  [F28B4.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGTTGGAATTGGGGGAT] 3' and primer B 5' [GCGTAGCGATTTAAGATTGGTC] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

8 Anatomy Terms

Definition Name Synonym Primary Identifier
female genital. vulva   WBbt:0006748
Epidermal layer. hypodermis epidermis WBbt:0005733
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
H-shaped cell associated with the excretory system, largest cell in C. elegans. excretory cell excretory canal cell WBbt:0005812
A free-floating spherical cell lying in the pseudocoelomic cavity of larvae and adult C. elegans which can endocytose many compounds, possibly for immune surveillance. There are six coelomocytes in adult hermaphrodites, and they display prominent cytoplasmic inclusions and vacuoles. coelomocyte   WBbt:0005751
epithelium connecting intestine and anus. rectal epithelium   WBbt:0005800
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00017891 rgl-1 F28B4.2 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023