WormMine: ExpressionPattern Expr5872

• Pattern: Adult Expression: pharyngeal gland cells; pharyngeal-intestinal valve; intestine - ant and post cells; hypodermis; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharyngeal gland cells; pharyngeal-intestinal valve; intestine - ant and post cells; hypodermis; seam cells; unidentified cells in head; unidentified cells in body ;unidentified cells in tail
• Primary Identifier: Expr5872
• Remark: Also expressed in (comments from author) : unidentified tissue in body, is part of the developing reproductive system Strain: BC12751
• Reporter Gene: [F26A1.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAAGAAGGACTGGTTTGTGATTG] 3' and primer B 5' [GATCGAGGCGATTTTCAGAC] 3'.

8 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
A group of six equivalent cells forms a tightly constructed `valve` that links the posterior bulb of the pharynx to the anterior four cells of the intestine. These six cells comprise a small epithelial channel with a cuticular lining in continuity with the pharyngeal cuticle and link the lumen of the pharynx to the large lumen of the anterior intestine.	pharyngeal-intestinal valve	cardia	WBbt:0005767
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages.	intestine	gut	WBbt:0005772
Epidermal layer.	hypodermis	epidermis	WBbt:0005733
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail	seam cell	lateral hypodermis	WBbt:0005753
Secretory gland cell of the pharynx	Pharyngeal gland cell		WBbt:0005788
posterior region, from rectum to the end	tail		WBbt:0005741
anterior-most body region containing the pharynx.	head		WBbt:0005739
region of the body by which tissues, cells or cell parts are classified	body region		WBbt:0005738

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00017806	F26A1.8	F26A1.8	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023