WormMine: ExpressionPattern Expr7065

• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; spermatheca; body wall muscle; seam cells; Larval Expression: pharynx; body wall muscle
• Primary Identifier: Expr7065
• Remark: Strain: BC12877
• Reporter Gene: [Y55F3AM.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTCAAAAGCTCAGTTTCCG] 3' and primer B 5' [TTTCCCGCGATTTTTCTG] 3'.

6 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
an accordion-like tube that contains sperm and is the site of oocyte fertilization.	spermatheca		WBbt:0005319
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion.	body wall musculature	body muscle	WBbt:0005813
muscle associated with hermaphrodite vulva.	vulval muscle		WBbt:0005821
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail	seam cell	lateral hypodermis	WBbt:0005753
	reproductive system		WBbt:0005747

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00021922	atg-3	Y55F3AM.4	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023