WormMine: ExpressionPattern Expr6820

• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; head mesodermal cell; seam cells; coelomocytes; Nervous System; head neurons; tail neurons; Larval Expression: stomato-intestinal muscle; anal depressor muscle; head mesodermal cell; seam cells; coelomocytes; Nervous System; head neurons; tail neurons
• Primary Identifier: Expr6820
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14995
• Reporter Gene: [W02B3.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACCTAGATTTTCTGAACTGTGCAT] 3' and primer B 5' [AGTGCTTTCTGATTCTGGAAAAAT] 3'.

9 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
a single, H-shaped cell which lies just above the anus and connects the roof of the anal canal to the dorsal bodywall; its contractions act to increase the size of the anal opening by lifting the roof of the rectum and hence facilitate expulsion of intestinal contents.	anal depressor muscle	dilator muscle	WBbt:0004292
neuron with its cell body situated in the tail, posterior to rectum.	tail neuron		WBbt:0006759
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail	seam cell	lateral hypodermis	WBbt:0005753
A free-floating spherical cell lying in the pseudocoelomic cavity of larvae and adult C. elegans which can endocytose many compounds, possibly for immune surveillance. There are six coelomocytes in adult hermaphrodites, and they display prominent cytoplasmic inclusions and vacuoles.	coelomocyte		WBbt:0005751
Head mesodermal cell, function unknown	head mesodermal cell	hmc	WBbt:0004697
left intestinal muscle cell, attach to intestine and body wall anterior to anus	mu_int_L	lineage name: ABplpppppaa	WBbt:0003833
right intestinal muscle cell, attach to intestine and body wall anterior to anus	mu_int_R	lineage name: MSppaapp	WBbt:0003822

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00020924	W02B3.4	W02B3.4	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023