WormMine: ExpressionPattern Expr6138

• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; Reproductive System; vulva other; hypodermis; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; hypodermis; unidentified cells in head; unidentified cells in tail
• Primary Identifier: Expr6138
• Remark: Strain: BC14294
• Reporter Gene: [F52D10.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTCTGCGTTGGTGGGTATT] 3' and primer B 5' [CCCAAGAACGGGATTGTCTA] 3'.

9 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
female genital.	vulva		WBbt:0006748
A group of six equivalent cells forms a tightly constructed `valve` that links the posterior bulb of the pharynx to the anterior four cells of the intestine. These six cells comprise a small epithelial channel with a cuticular lining in continuity with the pharyngeal cuticle and link the lumen of the pharynx to the large lumen of the anterior intestine.	pharyngeal-intestinal valve	cardia	WBbt:0005767
Epidermal layer.	hypodermis	epidermis	WBbt:0005733
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
posterior region, from rectum to the end	tail		WBbt:0005741
anterior-most body region containing the pharynx.	head		WBbt:0005739
	reproductive system		WBbt:0005747
left intestinal muscle cell, attach to intestine and body wall anterior to anus	mu_int_L	lineage name: ABplpppppaa	WBbt:0003833
right intestinal muscle cell, attach to intestine and body wall anterior to anus	mu_int_R	lineage name: MSppaapp	WBbt:0003822

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00009930	F52D10.2	F52D10.2	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023