WormMine: ExpressionPattern Expr6101

• Pattern: Adult Expression: Reproductive System; vulva other; spermatheca; hypodermis; Nervous System; nerve ring; head neurons; Larval Expression: Reproductive System; developing vulva; hypodermis; Nervous System; nerve ring; head neurons; unidentified cells in tail
• Primary Identifier: Expr6101
• Remark: Strain: BC13784
• Reporter Gene: [hmg-1.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACCTTCGAATGAAACGAGTGTT] 3' and primer B 5' [ACCAGAATTGATTGTTACTCGTTA] 3'.

8 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
an accordion-like tube that contains sperm and is the site of oocyte fertilization.	spermatheca		WBbt:0005319
female genital.	vulva		WBbt:0006748
Epidermal layer.	hypodermis	epidermis	WBbt:0005733
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes.	nerve ring	circumpharyngeal nerve ring	WBbt:0006749
posterior region, from rectum to the end	tail		WBbt:0005741
	reproductive system		WBbt:0005747

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00001972	hmg-1.2	F47D12.4	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023