WormMine

WS296

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; body wall muscle; excretory cell; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; body wall muscle; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; Primary Identifier  Expr6192
Remark  Also expressed in (comments from author) : Unidentified tail cell is possibly anal sphincter muscle. Cell in head is high-intensity GFP and is below the terminal bulb of the pharynx where it forms two low-intensity arms that go up into head and down to tail. Perhaps misplaced excretory cell? Strain: BC10680 Reporter Gene  [F55A12.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACGTTTAGTGCAAGTGATAACG] 3' and primer B 5' [GGTCCTGATCTTCAAAGAAAACA] 3'.

9 Anatomy Terms

Definition Name Synonym Primary Identifier
A group of six equivalent cells forms a tightly constructed `valve` that links the posterior bulb of the pharynx to the anterior four cells of the intestine. These six cells comprise a small epithelial channel with a cuticular lining in continuity with the pharyngeal cuticle and link the lumen of the pharynx to the large lumen of the anterior intestine. pharyngeal-intestinal valve cardia WBbt:0005767
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages. intestine gut WBbt:0005772
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
H-shaped cell associated with the excretory system, largest cell in C. elegans. excretory cell excretory canal cell WBbt:0005812
posterior region, from rectum to the end tail   WBbt:0005741
  rectal gland cell   WBbt:0005799
anterior-most body region containing the pharynx. head   WBbt:0005739
region of the body by which tissues, cells or cell parts are classified body region   WBbt:0005738

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00018866 nath-10 F55A12.8 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023