| Pattern | Expression is evident in both the metacorpus and terminal bulb of the adult pharynx. B-gal staining seems to be sub-cellularly localised in the pseudocircular m4 muscle cells in the metacorpus; staining in the terminal bulb is restricted to the posterior of the bulb, and so may mark the location of the m7 muscles. | Primary Identifier | Expr9566 |
| Reporter Gene | The Gateway destination vector (pDM#834) was constructed as follows: an 1,878 bp promoter region upstream of T05G5.1 was amplified from wild type (N2) genomic DNA using primers T05G5.1-Fo-Hind, TACTTAAGCTTTTCCTATCTCCG-3 and T05G5.1-Re-XmaI, TCCCCCGGGGCCTGAAGATAAGTGTGAA, and then inserted between the HindIII and XmaI sites of the GFP-encoding vector pPD95.75 (Fire LabVector Kit available at http://www.addgene.org/pgvec1?f=3Dc&cmd=3Dshowcol&colid=3D 1) to generate pDM#823. A second PCR fragment containing the attR sites and the ccdB gene from the pDEST24 destination vector (nucleotides 70=961777; Invitrogen) was amplified and cloned into p#DM823 between the MscI and KpnI cloning sites to generate pDM#834.This plasmid was transformed into the E. coli strain DB3.1 (Invitrogen), which is tolerant for the ccdB selectable marker gene. Entry clones were obtained from the ORFeome project (Open Biosystems) and cloned into the destination vector pDM#834 using the gateway strategy with LR clonase (Invitrogen) to make the pT05G5.1 ::ORF::GFP expression clones. | Subcellular Localization | Sub-cellular localization within the body wall muscle: Cytoplasm +/- Other |
| Definition | Name | Synonym | Primary Identifier |
|---|---|---|---|
| posterior segment of pharyngeal corpus. | metacorpus | WBbt:0003711 | |
| seventh pharyngeal muscle cell layer | pm7 | m7 | WBbt:0003721 |
| fourth pharyngeal muscle cell layer | pm4 | M4 | WBbt:0003739 |
| the last, posterior bulb of the pharynx. | terminal bulb | WBbt:0003732 |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00008514 | mrpl-44 | F02A9.4 | Caenorhabditis elegans |
