WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: rectal epithelium; Reproductive System; vulva other; spermatheca uterine valve; hypodermis; Nervous System; nerve ring; head neurons; tail neurons; Larval Expression: rectal epithelium; Reproductive System; developing vulva; hypodermis; Nervous System; nerve ring; head neurons; tail neurons; Primary Identifier  Expr7203
Remark  Also expressed in (comments from author) : No comments. Strain: BC14690 Reporter Gene  [ZK337.1b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTCAATTTTCTCGCAATTTTCTT] 3' and primer B 5' [TTAGCAGCCGGATTTCTAAAAG] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

9 Anatomy Terms

Definition Name Synonym Primary Identifier
female genital. vulva   WBbt:0006748
A valve tissue that connects the spermatheca and the uterus of a hermaphrodite gonad. spermathecal-uterine junction sp-ut valve WBbt:0006756
Epidermal layer. hypodermis epidermis WBbt:0005733
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
neuron with its cell body situated in the tail, posterior to rectum. tail neuron   WBbt:0006759
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes. nerve ring circumpharyngeal nerve ring WBbt:0006749
epithelium connecting intestine and anus. rectal epithelium   WBbt:0005800
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00013969 tep-1 ZK337.1 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023