WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharynx; anal depressor muscle; Reproductive System; vulval muscle; Nervous System; head neurons; amphids; unidentified cells in tail ; Larval Expression: anal depressor muscle; Nervous System; head neurons; amphids; unidentified cells in tail ; Primary Identifier  Expr5276
Remark  Also expressed in (comments from author) : Mosaic population. Strain: BC14096 Reporter Gene  [C16C10.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGTTATCGCTTTCAATTTGACT] 3' and primer B 5' [GCGAGCTGTGATTTCTGGA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

8 Anatomy Terms

Definition Name Synonym Primary Identifier
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
a single, H-shaped cell which lies just above the anus and connects the roof of the anal canal to the dorsal bodywall; its contractions act to increase the size of the anal opening by lifting the roof of the rectum and hence facilitate expulsion of intestinal contents. anal depressor muscle dilator muscle WBbt:0004292
posterior region, from rectum to the end tail   WBbt:0005741
neuron of the amphid sensillum amphid neuron amphid sensory neuron WBbt:0005394
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00007622 C16C10.1 C16C10.1 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023