WormMine: ExpressionPattern Expr5248

• Pattern: Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; Nervous System; ventral nerve cord; unidentified cells in body ; Larval Expression: pharynx; intestine; body wall muscle; unidentified cells in body
• Primary Identifier: Expr5248
• Remark: Also expressed in (comments from author) : High intensity GFP may mask tissues. Strain: BC10894
• Reporter Gene: [C13B9.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCTATGACAAAATTTCTACGCGA] 3' and primer B 5' [CGGCGATCAACACGATTG] 3'.

10 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
neuron with cell body associated with the ventral nerve cord.	ventral cord neuron	ventral cord motoneuron	WBbt:0005300
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages.	intestine	gut	WBbt:0005772
an accordion-like tube that contains sperm and is the site of oocyte fertilization.	spermatheca		WBbt:0005319
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion.	body wall musculature	body muscle	WBbt:0005813
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
muscle associated with hermaphrodite vulva.	vulval muscle		WBbt:0005821
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
five pairs of thin gonadal sheath cells form a single layer covering the germ line component of each arm, each pair occupying a stereotyped position along the gonad proximal-distal axis.	gonadal sheath cell		WBbt:0005828
	reproductive system		WBbt:0005747
region of the body by which tissues, cells or cell parts are classified	body region		WBbt:0005738

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00015734	copd-1	C13B9.3	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023