WormMine: ExpressionPattern Expr5153

• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; Reproductive System; uterus; body wall muscle; Nervous System; head neurons; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; body wall muscle; Nervous System; head neurons; unidentified cells in tail
• Primary Identifier: Expr5153
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC13956
• Reporter Gene: [pld-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTCTTGCGTCCTTACGATCC] 3' and primer B 5' [TGAATGGTCAAAATCAGACC] 3'.

8 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
A group of six equivalent cells forms a tightly constructed `valve` that links the posterior bulb of the pharynx to the anterior four cells of the intestine. These six cells comprise a small epithelial channel with a cuticular lining in continuity with the pharyngeal cuticle and link the lumen of the pharynx to the large lumen of the anterior intestine.	pharyngeal-intestinal valve	cardia	WBbt:0005767
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion.	body wall musculature	body muscle	WBbt:0005813
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
The organ in which the eggs are developed and protected until laid.	uterus		WBbt:0006760
posterior region, from rectum to the end	tail		WBbt:0005741
	reproductive system		WBbt:0005747

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00004040	pld-1	C04G6.3	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023