WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharynx; anal depressor muscle; Reproductive System; vulva other; spermatheca; gonad sheath cells; body wall muscle; hypodermis; unidentified cells in head; Larval Expression: pharynx; anal depressor muscle; body wall muscle; hypodermis; unidentified cells in head; Primary Identifier  Expr5140
Remark  Also expressed in (comments from author) : unidentified cells in head, possibly neural Strain: BC13981 Reporter Gene  [C04C3.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGGTTTAGATTACGACCAGGC] 3' and primer B 5' [ACTTTCTCAGAGCGATTTCGAC] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

9 Anatomy Terms

Definition Name Synonym Primary Identifier
female genital. vulva   WBbt:0006748
an accordion-like tube that contains sperm and is the site of oocyte fertilization. spermatheca   WBbt:0005319
Epidermal layer. hypodermis epidermis WBbt:0005733
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
a single, H-shaped cell which lies just above the anus and connects the roof of the anal canal to the dorsal bodywall; its contractions act to increase the size of the anal opening by lifting the roof of the rectum and hence facilitate expulsion of intestinal contents. anal depressor muscle dilator muscle WBbt:0004292
five pairs of thin gonadal sheath cells form a single layer covering the germ line component of each arm, each pair occupying a stereotyped position along the gonad proximal-distal axis. gonadal sheath cell   WBbt:0005828
anterior-most body region containing the pharynx. head   WBbt:0005739
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00015413 pdhb-1 C04C3.3 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023