WormMine: ExpressionPattern Expr5595

• Pattern: Adult Expression: pharynx; rectal epithelium; amphid socket cells; unidentified cells in head; Larval Expression: pharynx; rectal epithelium; hypodermis; amphid socket cells; unidentified cells in head
• Primary Identifier: Expr5595
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15275
• Reporter Gene: [grl-17::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCGACGCTAAGGACAGAAAA] 3' and primer B 5' [GAGGATGCCTTGTTGGTTACA] 3'.

6 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
Epidermal layer.	hypodermis	epidermis	WBbt:0005733
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
Amphid socket cell, left	AMsoL	lineage name: ABplpaapapa	WBbt:0003931
Amphid socket cell, right	AMsoR	lineage name: ABprpaapapa	WBbt:0003929
anterior-most body region containing the pharynx.	head		WBbt:0005739
epithelium connecting intestine and anus.	rectal epithelium		WBbt:0005800

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00001726	grl-17	C56A3.1	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023