WormMine: AnatomyTerm WBbt:0003929

• Definition: Amphid socket cell, right
• Name: AMsoR
• Primary Identifier: WBbt:0003929
• Synonym: lineage name: ABprpaapapa

2 Children

Definition	Name	Synonym	Primary Identifier
AMsoR cell in male animal.	AMsoR male		WBbt:0008622
AMsoR cell in hermaphrodite animal.	AMsoR hermaphrodite		WBbt:0008621

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Top 300 transcripts enriched in AMsoL, AMsoR according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:AMso

39 Expression Patterns

• Primary Identifier: Expr4828
• Remark: Picture: Fig. 6A Reporter gene fusion type not specified.
• Pattern: The unc-33::gfp reporter is expressed in dividing neuroblasts at pre-comma embryonic stages. unc-33::gfp expression can be observed outside the nervous system in two amphid socket cells and weakly in non-neuronal pharyngeal cells.

• Primary Identifier: Expr4684
• Pattern: GFP expression was detected at most developmental stages, with the spatial expression depending on the developmental stage of the animal. Neuronal expression of hlh-29 was detected in larvae and adults in both amphid and phasmid sockets, in the ALA and PVT neurons, in the chemosensory and mechanosensory neurons, ASI, ASK, PHA, and PQR, and in neurons of the anterior pharyngeal bulb. Weaker expression was also detected in the ASG chemosensory neurons in some transgenic lines. L1 animals show strong expression of hlh-29 in intestinal cells, and weaker expression in the rectal glands and the pharyngeal muscle cell PM1. By L3 stage, intestinal expression of the hlh-29::GFP is limited to the posterior intestinal cells, and PM1 expression is no longer detected. Expression is also detected in the ventral posterior coelomocytes in the later L3-stage larvae, and in the spermatheca and vulval muscles of L4 and adult animals.

• Primary Identifier: Expr4983
• Remark: Picture: Figure 4a-i.
• Pattern: High levels of constitutive GFP expression was observed in the pre-anal, vulval, hypodermal, glial amphid socket and excretory duct cells of the adult animal.

• Primary Identifier: Expr4452
• Pattern: Expressed in socket cells of amphids.

• Primary Identifier: Expr4441
• Pattern: Expressed in socket cells of amphids, IL or OLQ.

• Primary Identifier: Expr5178
• Remark: Strain: BC15183
• Reporter Gene: [srp-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAGCTTGGTTTTGAAATTTTGG] 3' and primer B 5' [CGGACATTGTCGGAAAATTATG] 3'.
• Pattern: Adult Expression: hypodermis; Larval Expression: hypodermis; amphid socket cells

• Primary Identifier: Expr5345
• Remark: Strain: BC13003
• Reporter Gene: [C26F1.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTTGTTAACGGGTTTTTAAGTGA] 3' and primer B 5' [TTTTAGGTGAAGTGGGTCGTG] 3'.
• Pattern: Adult Expression: rectal epithelium; amphid socket cells; unidentified cells in tail ; Larval Expression: rectal epithelium; hypodermis; seam cells; amphid socket cells; unidentified cells in tail

• Primary Identifier: Expr5683
• Remark: Also expressed in (comments from author) : Embryo incomplete. Strain: BC11948
• Reporter Gene: [rhr-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGATGTGGTTGAATCGTCGTC] 3' and primer B 5' [TTTTGTTTCGGTTGAATTACTGA] 3'.
• Pattern: Adult Expression: intestine; rectal gland cells; Reproductive System; spermatheca; hypodermis; seam cells; Nervous System; tail neurons; Larval Expression: intestine; developing spermatheca; gonad sheath cells; excretory cell; Nervous System; amphid socket cells

• Primary Identifier: Expr5595
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15275
• Reporter Gene: [grl-17::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCGACGCTAAGGACAGAAAA] 3' and primer B 5' [GAGGATGCCTTGTTGGTTACA] 3'.
• Pattern: Adult Expression: pharynx; rectal epithelium; amphid socket cells; unidentified cells in head; Larval Expression: pharynx; rectal epithelium; hypodermis; amphid socket cells; unidentified cells in head

• Primary Identifier: Expr5534
• Remark: Strain: BC12759
• Reporter Gene: [egl-19::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCGTTGCACCCTTCTTG] 3' and primer B 5' [CCTGACATGATGGACACAGG] 3'.
• Pattern: Adult Expression: pharynx; intestine; hypodermis; amphid socket cells; unidentified cells in head; unidentified cells in tail ; Embryo Expression: intestine; Larval Expression: pharynx; intestine; hypodermis; amphid socket cells; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr6584
• Remark: Also expressed in (comments from author) : ASJ amphid neuron (Hobert Lab 2005). Strain: BC13576
• Reporter Gene: [sru-19::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGAAAAATTCCACAAAAATATG] 3' and primer B 5' [GCAATTCCAACGAAAATTTGA] 3'.
• Pattern: Adult Expression: Nervous System; amphids; amphid socket cells; Larval Expression: Nervous System; amphids; amphid socket cells

• Primary Identifier: Expr6503
• Remark: Also expressed in (comments from author) : Embryo and adult incomplete. To be updated. Strain: BC14319
• Reporter Gene: [R11A8.7a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGTTTTTCTCATATTTGTTTCT] 3' and primer B 5' [TTTCTAATGGAATGAGGTGATTGA] 3'.
• Pattern: Larval Expression: pharynx; intestine; rectal epithelium; developing vulva; hypodermis; seam cells; Nervous System; head neurons; amphid socket cells; neurons along body; unidentified cells in head

• Primary Identifier: Expr9099
• Remark: Picture: Fig 3.
• Pattern: This mab-31 2Kb 5' flanking sequence was active in gut cells of the pretzel-stage embryo and throughout the larval stages. In adult males and hermaphrodites, gfp reporter signal was observed in the pharynx, body hypodermis, and intestine. On the other hand, mab-31 expression is also observed in support cells of neuronal sensilla, like amphid socket cells and phasmid socket cells. In the wild-type male tail, the mab-31 transcriptional reporter expression was detected in structural cells highlighting the cell bodies and processes of all sensory rays.

• Primary Identifier: Expr6730
• Remark: Also expressed in (comments from author) : Mosaic population.Neural head and tail is possibly amphid/phasmid, but masked by pharynx and hypodermis Strain: BC11319
• Reporter Gene: [T21D12.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCACTCGTGACGCATTTG] 3' and primer B 5' [CTGGTGGAAGAGGGATTTTCT] 3'.
• Pattern: Adult Expression: pharynx; intestine; stomato-intestinal muscle; Reproductive System; distal tip cell; uterine-seam cell; vulval muscle; spermatheca; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; amphid socket cells; neurons along body; tail neurons; unidentified cells in body ; Larval Expression: pharynx; intestine; stomato-intestinal muscle; Reproductive System; distal tip cell; developing vulva; developing uterus; developing spermatheca; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; amphid socket cells; neurons along body; tail neurons; unidentified cells in body

• Primary Identifier: Expr6726
• Remark: Also expressed in (comments from author) : Unidentified cells in head, are possibly nuclei of the nerve ring. And what we thought were arcade cells, may actually be the 2 amphid socket cells. Strain: BC11318
• Reporter Gene: [T21B10.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGCTCTACGCAAGTTATTTCAG] 3' and primer B 5' [TCTTGGTGATTGGGATCCTG] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal gland cells; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; uterine muscle; vulval muscle; spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; Larval Expression: pharynx; intestine; rectal gland cells; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; amphid socket cells; tail neurons; unidentified cells; unidentified cells in head

• Primary Identifier: Expr6701
• Remark: Also expressed in (comments from author) : Unidentified cells in head possibly amphid cells, or amphid sheath cells. Strain: BC12852
• Reporter Gene: [grl-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAACTTACCACACCTGCACA] 3' and primer B 5' [AAGTGCAGTTAGGATACTTGGTA] 3'.
• Pattern: Adult Expression: Nervous System; amphid socket cells; tail neurons; unidentified cells in head; unidentified cells in body ; Larval Expression: Nervous System; amphid socket cells; tail neurons; unidentified cells in head; unidentified cells in body

• Primary Identifier: Expr6380
• Remark: Also expressed in (comments from author) : No comments. Strain: BC12856
• Reporter Gene: [grl-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGTGTTGTGCCAGATTTGT] 3' and primer B 5' [CAAATATGGAATGGAAGTGGAAG] 3'.
• Pattern: Larval Expression: intestine; Nervous System; head neurons; amphid socket cells; tail neurons

• Primary Identifier: Expr12196
• Pattern: To determine where lite-1 is expressed and identify likely sites of lite-1 function, the authors generated and examined worms carrying one of four transgenes derived from the wild-type lite-1 locus: a genomic fragment (lite-1 genomic), a transcriptional fusion (lite-1prom::gfp), a C-terminal translational fusion (lite-1prom::lite-1::gfp), and an N-terminal translational fusion (lite-1prom::gfp::lite-1). GFP expression was observed in a total of 29 cells: pharyngeal neurons M1, M4, M5, and MI; non-pharyngeal neurons ASK, ADL, ASI, ASH, AVG, AVB, RIM, ADF, PHA, PHB, and PVT; and non-neuronal cells Hyp3 (hypoderm), AMso (amphid socket cells), and PHso (phasmid socket cells). AVB was observed only with the C-terminal fusion transgene, and RIM and ADF were observed only with the transcriptional fusion transgene. lite-1 expression in AVG and PVT was previously reported.

• Primary Identifier: Expr14012
• Pattern: ASK, ASI, ASH, ASJ, one pair posterior to AWB (some space in btw), PHA, PHB, one pair just posterior to PHB (sometimes dimmer), HSN, AVM, BDU, Amso, ray expression in males

• Primary Identifier: Expr6954
• Remark: Also expressed in (comments from author) : NSM neurons in the head (Hall Lab, 2005). Strain: BC11521
• Reporter Gene: [abt-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTGCTTTGGAATTTCAGGT] 3' and primer B 5' [CAATGCACCGATTCTGAAAA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; hypodermis; Nervous System; head neurons; amphid socket cells; pharyngeal neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; hypodermis; Nervous System; head neurons; amphid socket cells; pharyngeal neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr7255
• Remark: Strain: BC10505
• Reporter Gene: [ZK792.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGAGAACAAACTGGTAAAGGGA] 3' and primer B 5' [ACGTTCTGATGAGATTGAAACTT] 3'.
• Pattern: Adult Expression: pharynx; Nervous System; head neurons; Larval Expression: pharynx; intestine; rectal gland cells; Nervous System; amphid socket cells; unidentified cells in head

• Primary Identifier: Expr3025
• Pattern: The iri-1::gfp is expressed in the terminal bulb of the pharynx, amphid socket cells, pharyngeal-intestinal valve, intestine, excretory cell, rectal epithelial cells, and vulva hypodermis. In addition, iri-1::gfp is expressed in the corpus of the pharynx, the pharyngeal neuron I3, the anal sphincter and in the gonad precursor cells Z1 and Z4.

• Primary Identifier: Expr14140
• Pattern: ASI (dim), BAG, (I4), 3 more head neuron pairs, DD, VD, Amso, PHsh or Phso

• Primary Identifier: Expr8845
• Remark: Picture: Fig 3.
• Pattern: Neuronal Expression: AVA, AVB, AVD, AVE, PVC, AIB, AIN, AUA, AVH?, AVJ, RIC, RMD, SMD, I2. Non-neuronal Expression: hypodermis, pharyngeal muscle, amphid socket.

• Primary Identifier: Expr3525
• Remark: The alr-1p::GFP reporter construct was generated by inserting 1 kb of upstream regulatory sequence into the pPD95.75 vector, which contains the green fluorescent protein (GFP) coding sequence and the 3' untranslated region of unc-54 at the 3' end. This construct was injected into N2 worms at 10 ng/ul along with a PCR product corresponding to 6 kb of overlapping alr-1 upstream regulatory sequence and a dominant Roller marker, pRF4 containing rol-6 (su1006),at 100 ng/ul to generate kuEx146.
• Pattern: Embryonic analysis indicated an early expression pattern just after the 28-cell stage. The strongest expression at this point was seen in descendants of the C linage as well as less prominent expression within a subset of the AB lineage. By the comma stage (-400 cells), GFP expression was apparent in alternating dorsal hypodermal cells before the onset of cell fusions. After the onset of the hypodermal cell fusions, GFP was apparent throughout the hyp7 hypodermal syncytium. At the comma stage, GFP was also strongly expressed in the precursors to the PLM and ALN neurons, the T-cells (precursors to the phasmid socket cells), and the cells that would comprise the hyp4 anterior hypodermal syncytium. These cells were tentatively identified based on cell position and the strong expression seen within the adult structures derived from these cells. A number of GFP-expressing cells within the head region of the embryo remained unidentified. These cells likely include a number of head and pharyngeal neurons, although other cells types are not ruled out. Expression in the larval and adult hermaphrodite was primarily restricted to a subset of neurons and neuronal support cells. The PLM, ALM, and AVM touch neurons and the intrinsic pharyngeal neurons I2 and I6 all showed very strong expression throughout all larval stages and adulthood. The RIS neuron and one other unidentified, unpaired neuronal cell body located in the retrovesicular ganglion occasionally showed faint expression. Strong expression was also seen in the glial-like amphid and phasmid socket cells (AMso and PHso 1 and 2) throughout larval development and adulthood. Strong GFP expression was also observed within the hyp6 and hyp4 hypodermal syncytia, the distal most segments of the intestine and the coelomocytes, the scavenger cells located within the pseudocoelom. Variable GFP expression was also seen in larval and adult worms within the hyp7 hypodermal syncytium. Importantly, GFP expression was not observed in 23 of the 24 GABAergic neurons (the sole exception being the RIS neuron) that have been shown previously to stain with anti-ALR-1 antibodies (See Expr3487). This suggested that the sequences required for ALR-1 expression in these neurons may reside outside of the 6 kb of promoter sequence driving this GFP reporter. Alternatively, GFP expression from this construct may not be readily detectable above background fluorescence in these specific neurons.

• Primary Identifier: Expr646
• Remark: Reporter gene fusion type not specified. This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: wrt-6 is expressed in the nuclei of four to seven sheath and socket cells of the anterior sensilla. Staining is observed in amphid and inner labial socket cells. Some worms show additional staining in seam cells and hypodermal syncytia.

• Primary Identifier: Expr14087
• Remark: Other Strain: OH14338
• Pattern: ADL, other head neurons in anterior and ventral ganglion (much dimmer), PHA, PHB, vulva, anterior sheath/socket cells (Amsh/Amso?), males - expression in rays

• Primary Identifier: Expr8111
• Remark: Picture: Fig. 6. ant-1.4 = T01B11.4
• Pattern: The ANT-1.4::GFP is expressed in a pair of neurons that sends a ciliary process to the tip of the head. Occasionally, green fluorescent protein (GFP) is also detected in the amphid socket and sheath cells. Expression is detected in one neuron located in the nerve cord identified as the VA11 motoneuron and occasionally in the rectal gland cell and at a lower level in an other motoneuron. The GFP signal is observed in the ventral nerve cord in neural processes that go to the nerve ring. The signal is also seen in a few body-wall muscle cells and the vulval muscle cells.

• Primary Identifier: Expr2202
• Pattern: ver-1 was expressed in neural and muscular cell types localized in the anterior and posterior regions of the worm. The sheath, and very rarely the socket cells of the amphid and phasmid generally exhibited a bright fluorescence indicative of ver-1 promoter activity. In agreement with amphid sheath cell development, ver-1 expression was observed from the late embryonic stage to the adult, and for the phasmid sheath cells at the L1 stage, a stage when the cellular processes of the phasmid sheath cells are still lacking. They were identified by the channel they made for the chemosensory neurons after Dil dye filling. The ver-1 gene was upregulated at the dauer state. Beside these neural cell types, a frequent expression of the ver-1::gfp was observed in the muscular intestinal cell, which participates in the defecation process, and in the first and last intestinal cells, but rarely in other intestinal cells, indicating that this expression was not due to some unspecific expression by the gut.

• Primary Identifier: Expr11010
• Pattern: Pmir-235::gfp is apparently expressed in the entire hypodermis from late embryogenesis to adult. In addition to the hypodermis, its expression was also seen in glia-like socket cells surrounding amphid neurons during L1 diapause (AmsoL/R). By northern blotting it was observed that the level of mature miR-235 progressively increased during the period of L1 diapause.

11 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The whole period of embryogenesis in the nematode Caenorhabditis elegans, from the formation of an egg until hatching.		embryo Ce	WBls:0000003
	The C. elegans life stage spanning 620-800min(hatch) after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. A stage after elongation is over. The last stage of embryogenesis. Also called pre-hatched embryo, late embryo or morphogenetic embryo.		fully-elongated embryo Ce	WBls:0000021
	The C. elegans life stage spanning 350-620min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The stage that embryo starts elongation until elongation is over.		elongating embryo Ce	WBls:0000015
	The C. elegans life stage spanning 290-350min after first cleavage at 20 Centigrade. Proliferate from 421 cells to 560 cells. The stage when embryo just finished gastrulation and is enclosing.		enclosing embryo Ce	WBls:0000013
	The C. elegans life stage spanning 0-350min after first cleavage at 20 Centigrade. Proliferate from 1 cell to 560 cells. From start of first cleavage until cleavage is over.		proliferating embryo Ce	WBls:0000004
	The C. elegans life stage spanning 520-620min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The shape of embryo is elongated and tripple fold. A stage between 2-fold embryo and fully-elongated embryo. Also called pretzel embryo or pretzel stage.		3-fold embryo Ce	WBls:0000020
	The C. elegans life stage spanning 420-460min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The shape of embryo is elongated and fold back 50%. A stage between comma embryo and 2-fold embryo.		1.5-fold embryo Ce	WBls:0000018
	The C. elegans life stage spanning 390-420min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The shape of embryo looks like a comma. A stage between bean embryo and 1.5-fold embryo.		comma embryo Ce	WBls:0000017
	The C. elegans life stage spanning 460-520min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The shape of embryo is elongated and double fold. A stage between 1.5-fold embryo and 3-fold embryo.		2-fold embryo Ce	WBls:0000019
	The C. elegans life stage spanning 350-390min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. Emrbyo elongation started but have not formed comma shape yet. The shape of embryo looks like a lima bean. A stage right before comma embryo. Also called lima embryo or lima bean stage.		bean embryo Ce	WBls:0000016
	The C. elegans life stage spanning 210-350min after first cleavage at 20 Centigrade. Proliferate from 421 cells to 560 cells. The stage before the fast cleavage of cells finishes.		late cleavage stage embryo Ce	WBls:0000014

4 Parents

Definition	Name	Synonym	Primary Identifier
epithelial support cell of the amphid sensilla.	amphid socket cell	AMso	WBbt:0008379
embryonic cell	ABprpaapap		WBbt:0006105
portion of anterior ganglion of somatic nervous system that is anterior to the metacorpus of pharynx.	anterior ganglion (ant)		WBbt:0005372
	amphid right sensillum		WBbt:0005392