WormMine: ExpressionPattern Expr6561

• Pattern: Adult Expression: pharynx; excretory cell; Nervous System; head neurons; tail neurons; Larval Expression: pharynx; excretory cell; Nervous System; head neurons; tail neurons
• Primary Identifier: Expr6561
• Remark: Also expressed in (comments from author) : Neural in the tail is possibly the phasmid sheath cells. Strain: BC10615
• Reporter Gene: [aak-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATCGACATTCGAGAGGATTTAC] 3' and primer B 5' [GAAAAGATTTCTGAAAATAGTCGG] 3'.

5 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
neuron with its cell body situated in the tail, posterior to rectum.	tail neuron		WBbt:0006759
H-shaped cell associated with the excretory system, largest cell in C. elegans.	excretory cell	excretory canal cell	WBbt:0005812

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00020142	aak-2	T01C8.1	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023