WormMine: Gene WBGene00020142

• WormBase Gene ID: WBGene00020142
• Gene Name: aak-2
• Sequence Name: T01C8.1
• Brief Description: aak-2 encodes one of two C. elegans homologs of the catalytic alpha subunit of AMP-activated protein kinases (AMPKs); in C. elegans, aak-2 functions downstream of environmental stressors, energy level signals (AMP:ATP ratio), and daf-2-mediated insulin signaling to positively regulate adult lifespan; in regulating lifespan, aak-2 likely acts in parallel with daf-16/FOXO; aak-2 activity is also required for dauer formation in daf-2 mutant animals at high temperature in a manner independent of the AMP:ATP ratio; in the germline, aak-2 functions downstream of daf-2 and daf-7, and in parallel to par-4 and aak-1, to negatively regulate germline proliferation during dauer development; in vitro, AAK-2 exhibits AMP-enhanced kinase activity against a known AMPK substrate, the SAMS peptide.
• Organism: Caenorhabditis elegans
• Automated Description: Enables AMP-activated protein kinase activity. Involved in several processes, including determination of adult lifespan; nematode pharyngeal pumping; and regulation of protein secretion. Located in axon; cytoplasm; and neuronal cell body. Expressed in several structures, including body wall musculature; excretory canal; interfacial epithelial cell; neurons; and reproductive system. Human ortholog(s) of this gene implicated in several diseases, including Huntington's disease; colon cancer; and type 2 diabetes mellitus. Is an ortholog of human PRKAA1 (protein kinase AMP-activated catalytic subunit alpha 1) and PRKAA2 (protein kinase AMP-activated catalytic subunit alpha 2).
• Biotype: SO:0001217
• Genetic Position: X :24.0613 ±0.00069
• Length (nt): 7312

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00020142

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:T01C8.1a.1	T01C8.1a.1	2371	X: 16796087-16803344
Transcript:T01C8.1b.1	T01C8.1b.1	2429	X: 16796089-16803398
Transcript:T01C8.1c.1	T01C8.1c.1	2214	X: 16799707-16803332

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:T01C8.1a	T01C8.1a	1875	X: 16796089-16796231
CDS:T01C8.1b	T01C8.1b	1881	X: 16796089-16796231
CDS:T01C8.1c	T01C8.1c	1689	X: 16799750-16799870

34 RNAi Result

• WBRNAi00082231
• WBRNAi00082233
• WBRNAi00084941
• WBRNAi00084935
• WBRNAi00070305
• WBRNAi00102846
• WBRNAi00102847
• WBRNAi00052109
• WBRNAi00017958
• WBRNAi00076627
• WBRNAi00114384
• WBRNAi00035012
• WBRNAi00108294
• WBRNAi00082232
• WBRNAi00082234
• WBRNAi00093039
• WBRNAi00114380
• WBRNAi00078068
• WBRNAi00084952
• WBRNAi00092790
• WBRNAi00109104
• WBRNAi00102798
• WBRNAi00102842
• WBRNAi00098419
• WBRNAi00102894
• WBRNAi00084947
• WBRNAi00084946
• WBRNAi00078067
• WBRNAi00070302
• WBRNAi00070304

112 Allele

• gk964260
• gk962707
• gk963810
• gk963581
• rr48
• WBVar01929543
• gk564927
• gk306572
• gk306576
• gk306575
• gk306574
• gk306573
• gk306583
• gk306582
• gk306581
• gk306580
• gk306579
• gk306578
• gk306577
• gk306586
• gk306585
• gk306584
• gk306593
• gk306592
• gk306591
• gk306590
• gk306589
• gk306588
• gk306587
• bz179

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00020142
• Start: 16796087
• End: 16803398
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

133 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA.	Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference.	WBPaper00045974:NSM_enriched_totalRNA_RNAseq
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:daf-2(e1370)_upregulated
Bacteria infection: Staphylococcus aureus	mRNAs that showed increased expression 8 hours after N2 animals were infected by S. aureus.	DESeq, p <= 0.05	WBPaper00045314:S.aureus-induced_N2
	Transcriptions that showed significantly increased expression in skn-1(RNAi) comparing to empty vector injection into rrf-3(pk1426);daf-2(e1368) animals.	Genes with an absolute fold changeof at least 2 and standard p-values below 0.05 were considered as differentially expressed.	WBPaper00062193:skn-1(RNAi)_upregulated
	Transcripts that showed significantly increased expression in dpy-21(e428) comparing to in N2 during L3 stage.	DESeq v1.6.3. Fold change > 1.5.	WBPaper00050370:dpy-21(e428)_L3_upregulated
	Proteins identified in extracellular vesicle.	N.A.	WBPaper00062669:extracellular-vesicle_protein
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult

15 Expression Patterns

• Primary Identifier: Expr6560
• Remark: Strain: BC10616
• Reporter Gene: [T01C8.1a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATCGACATTCGAGAGGATTTAC] 3' and primer B 5' [GAAAAGATTTCTGAAAATAGTCGG] 3'.
• Pattern: Adult Expression: pharynx; excretory cell; Nervous System; head neurons; Larval Expression: pharynx; excretory cell; Nervous System; head neurons

• Primary Identifier: Expr6561
• Remark: Also expressed in (comments from author) : Neural in the tail is possibly the phasmid sheath cells. Strain: BC10615
• Reporter Gene: [aak-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATCGACATTCGAGAGGATTTAC] 3' and primer B 5' [GAAAAGATTTCTGAAAATAGTCGG] 3'.
• Pattern: Adult Expression: pharynx; excretory cell; Nervous System; head neurons; tail neurons; Larval Expression: pharynx; excretory cell; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr2009053
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr11585
• Pattern: Head Paak-2::GFP expression is mostly seen in the excretory cell but is also observed in pharyngeal neurons, epithelial cells, a subset of ring neurons, amphid socket cells and head body wall muscles. Paak-2::GFP is also expressed in the posterior intestine, rectal gland and epithelial cells, and in phasmids. Paak-2::GFP is detected in vulval muscles. For a summary of Paak-2::GFP see table S10.

• Primary Identifier: Expr10563
• Pattern: aak-2 is widely and strongly expressed during dauer. An aak-2p::AAK-2N::GFP truncated translational fusion protein is expressed in pharyngeal muscles, nervous system, coelomocytes, hypodermis, excretory cell, muscles, intestine, whole animal.

• Primary Identifier: Expr16393
• Pattern: AAK-2c was expressed in various tissues, including the pharynx, intestine, muscles, hypodermis, and neurons, consistent with previous AAK-2 expression.

• Primary Identifier: Expr10663
• Pattern: During L1 diapause, Paak-2::aak-2::gfp was highly expressed in most tissues including the intestine, excretory canal, pharynx, somatic gonad, neurons, hypodermis, and body wall muscle.

• Primary Identifier: Expr8159
• Remark: Picture: Figure 3.
• Pattern: In the transgenic C. elegans line expressing the AAK-2::GFP fusion protein, expression was observed in the pharynx, the ventral cord, other neurons including the hermaphrodite-specific neuron (HSN), body wall muscles, the vulva, the excretory canal, and weakly in the intestine. GFP expression was also seen in the distal tip cells, spermatheca, and sheath cells.
• Subcellular Localization: In ventral cord motor neurons, the protein was found in the axons and the cytoplasm of the cell bodies, where it accumulated in two foci.

• Primary Identifier: Expr13937
• Pattern: Broad aak- 2::GFP expression was observed in the pharynx, gut, and nervous and reproduction systems of the young adult animals.

• Primary Identifier: Expr13139
• Pattern: A rescuing translational fusion reporter [Paak-2::aak-2::GFP] was broadly expressed throughout the nervous system.

• Primary Identifier: Expr16392
• Pattern: AAK-2a was expressed in only a few head neurons and excretory cells.

• Primary Identifier: Expr1038760
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1155741
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2027289
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1028354
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

24 GO Annotation

13 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00020142
• Start: 16796087
• End: 16803398
• Strand: 1

24 Ontology Annotations

7 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	mRNAs that showed differential expression in activated AAK-2(uthIs202[aak-2 (intron 1)::aak-2(aa1-aa321)::Tomato::unc-54 3'UTR + rol-6(su1006)]), activiated CRTC-1 (uthEx222[crtc-1p::crtc-1 cDNA (S76S, S179A)::tdTomato::unc-54 3'UTR + rol-6(su1006)]), or AAK-2;CRTC-1 comparing to in N2.	Genes were tested for differential expression between each mutant strain and wild-type using edgeRs glm method. Briefly, negative binomial models were fitted and dispersion estimates obtained. These were then used to calculate average levels of change between conditions and determine differential expression, using the generalized linear model likelihood ratio test. For each comparison, genes with less than 5 CPM were filtered and those with at least 50% change and False Discovery Rate (FDR) of 1% or less were considered differentially expressed.	WBPaper00046499:AMPK_regulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly decreased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_downregulated
	Significantly up-regulated genes in unstressed aak-2(gt33) relative to N2.	Audic-Claverie test of statistical significance using normalized read frequencies (i.e. Normalized number of reads per gene = number of reads mapped to a gene * the read length (36 bases)/the gene length/total number of reads in the library) of commonly identified genes. Genes that had p-values less than 0.01 and log2 expression level ratios greater than 0.7 (Minimum of ~1.5 difference) for every comparison were selected as differentially expressed.	WBPaper00038118:aak-2(gt33)_upregulated
	Significantly down-regulated genes in unstressed aak-2(gt33) relative to N2.	Audic-Claverie test of statistical significance using normalized read frequencies (i.e. Normalized number of reads per gene = number of reads mapped to a gene * the read length (36 bases)/the gene length/total number of reads in the library) of commonly identified genes. Genes that had p-values less than 0.01 and log2 expression level ratios greater than 0.7 (Minimum of ~1.5 difference) for every comparison were selected as differentially expressed.	WBPaper00038118:aak-2(gt33)_downregulated
	Genes up regulated in aak-2 over expression line uthIs202[Paak-2c	To identify genes that were significantly differentially expressed between each mutant and the control, linear modelling and empirical Bayes analysis was performed using the limma package. Limma computes an empirical Bayes adjustment for the t-test (moderated t-statistic), which is more robust than the standard two-sample t-test comparisons. To correct for multiple testing, Benjamin and Hochbergs method to control for false discovery rate was used. Genes with an adjusted P value of 0.05 or smaller and a fold-change in expression larger than twofold were considered differentially expressed.	WBPaper00038172:aak-2overexpression_up_regulated
	Genes down regulated in aak-2 over expression line uthIs202 comparing to in N2.	To identify genes that were significantly differentially expressed between each mutant and the control, linear modelling and empirical Bayes analysis was performed using the limma package. Limma computes an empirical Bayes adjustment for the t-test (moderated t-statistic), which is more robust than the standard two-sample t-test comparisons. To correct for multiple testing, Benjamin and Hochbergs method to control for false discovery rate was used. Genes with an adjusted P value of 0.05 or smaller and a fold-change in expression larger than twofold were considered differentially expressed.	WBPaper00038172:aak-2overexpression_down_regulated

1 Sequence

• Length: 7312

1 Sequence Ontology Term