WormMine: ExpressionPattern Expr6625

• Pattern: Adult Expression: pharyngeal gland cells; intestine; Reproductive System; distal tip cell; uterus; vulval muscle; spermatheca; body wall muscle; unidentified cells in tail ; Larval Expression: pharyngeal gland cells; intestine; distal tip cell; body wall muscle; unidentified cells in tail
• Primary Identifier: Expr6625
• Remark: Strain: BC10814
• Reporter Gene: [moc-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGATGCAATTGTGAAAATAAATAA] 3' and primer B 5' [GGTGATGAGCAGCGATTTCT] 3'.

10 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages.	intestine	gut	WBbt:0005772
an accordion-like tube that contains sperm and is the site of oocyte fertilization.	spermatheca		WBbt:0005319
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion.	body wall musculature	body muscle	WBbt:0005813
muscle associated with hermaphrodite vulva.	vulval muscle		WBbt:0005821
Posterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad	posterior distal tip cell	gon herm dtc P	WBbt:0004506
Anterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad	anterior distal tip cell	gon herm dtc A	WBbt:0004520
The organ in which the eggs are developed and protected until laid.	uterus		WBbt:0006760
Secretory gland cell of the pharynx	Pharyngeal gland cell		WBbt:0005788
posterior region, from rectum to the end	tail		WBbt:0005741
	reproductive system		WBbt:0005747

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00003384	moc-1	T06H11.4	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023