WormMine: Gene WBGene00003384

• WormBase Gene ID: WBGene00003384
• Gene Name: moc-1
• Sequence Name: T06H11.4
• Brief Description: moc-1 encodes an ortholog of human GEPHYRIN (GPHN; OMIM:603930), which when mutated leads to molybdenum cofactor (MoCo) deficiency; MOC-1 is also paralogous to LIN-46.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable molybdopterin molybdotransferase activity. Predicted to be involved in Mo-molybdopterin cofactor biosynthetic process; postsynaptic neurotransmitter receptor diffusion trapping; and synapse organization. Predicted to be located in cytosol; dendrite; and postsynapse. Expressed in tail. Human ortholog(s) of this gene implicated in molybdenum cofactor deficiency type C. Is an ortholog of human GPHN (gephyrin).
• Biotype: SO:0001217
• Genetic Position: X :1.80708 ±0.023848
• Length (nt): 2492

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003384

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:T06H11.4.1	T06H11.4.1	1420	X: 10136129-10138620

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:T06H11.4	T06H11.4	1308	X: 10136239-10136691

3 RNAi Result

• WBRNAi00052692
• WBRNAi00018323
• WBRNAi00033458

33 Allele

• gk964260
• gk962707
• gk963793
• e2821
• WBVar01759017
• WBVar01759018
• WBVar02027299
• WBVar02027298
• gk918060
• gk351340
• gk741923
• WBVar01987611
• gk430393
• gk526548
• gk409151
• gk804508
• gk589114
• gk291226
• ttTi6550
• gk291225
• ok366
• WBVar01551656
• gk291230
• gk291229
• gk291228
• gk291227
• gk789406
• gk721858
• gk680420
• gk749262

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003384
• Start: 10136129
• End: 10138620
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_10133183..10136128
• Length (nt): 2946
• Chromosome Location: X: 10133183-10136128
• Organism: Caenorhabditis elegans

94 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in N2 after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_N2
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts that showed differential expression between 24 and 26 hours post hatching L2d and dauer committed larvae of daf-9(dh6), triggered by the dafachronic acid (DA) growth hormone. Cluster 3 genes increased expression transiently at 26 hour post hatching.	Benjamini Hochberg corrected q-value < 0.01.	WBPaper00053388:dauer_regulated_Cluster3
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_downregulated
	Proteins that showed significantly decreased expression in 1-day-old sek-1(km4) adults comparing to in wild type animals, both with 6 hours of cisplatin treatment.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:sek-1(km4)_downregulated_cisplatin
	Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:nuo-6(qm200)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:excretory-cell_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:intestine_L2-larva_expressed
Bacteria: B.thuringiensis	Transcripts in N2 animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407.	Cuffdiff	WBPaper00060358:B.thuringiensis_pathogen_regulated_N2
	Transcripts that showed altered expression from P0 to F2 generation animals after N2 parental generation were treated with antimycin, but not in damt-1(gk961032) P0 to F2 animals after the parenal generaton were treated with antimycin.	N.A.	WBPaper00055862:antimycin_damt-1(gk961032)_regulated
	Genes regulated by DAF-16, according to whole transcriptome profiling to compare genome-wide regulatory influences of DPY-21 and SET-4 to those of the key transcription factors controlling dauer arrest in eak-7;akt-1 animals, DAF-16 and DAF-12.	Authors identified genes differentially expressed between wild-type and eak-7;akt-1 double mutant animals [fold change >= 1.5 and false discovery rate (FDR) < 0.05]. Authors then compared the transcriptomes of eak-7;akt-1 double mutants to those of eak-7;akt-1 animals harboring mutations in dpy-21, set-4, daf-16, or daf-12, and identified genes that are differentially expressed in the opposite direction as in wild-type relative to eak-7;akt-1. Annotated gene expression data output from CuffDiff v2.2.1 was read into R version 3.2.1 for six comparisons: eak-7;akt-1 compared to (1) wild-type, (2) daf-16(mu86);eak-7;akt-1, (3) daf-12;eak-7;akt-1, (4) set-4(n4600);eak-7;akt-1, (5) set-4(dp268);eak-7;akt-1, and (6) dpy-21;eak-7;akt-1. Authors filtered genes by the following criteria: (1) status = OK for wild-type vs. eak-7;akt-1, (2) fold change (FC) >= 1.5 or FC <= 1/1.5 for wild-type vs. eak-7;akt-1 and (3) FDR < 0.05 for at least two separate comparisons.	WBPaper00050801:DAF-16_dauer_regulome
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)

7 Expression Patterns

• Primary Identifier: Expr1031558
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr6625
• Remark: Strain: BC10814
• Reporter Gene: [moc-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGATGCAATTGTGAAAATAAATAA] 3' and primer B 5' [GGTGATGAGCAGCGATTTCT] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; intestine; Reproductive System; distal tip cell; uterus; vulval muscle; spermatheca; body wall muscle; unidentified cells in tail ; Larval Expression: pharyngeal gland cells; intestine; distal tip cell; body wall muscle; unidentified cells in tail

• Primary Identifier: Expr6626
• Remark: Also expressed in (comments from author) : Unidentified cells in the tail. Strain: BC10813
• Reporter Gene: [moc-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGATGCAATTGTGAAAATAAATAA] 3' and primer B 5' [GGTGATGAGCAGCGATTTCT] 3'.
• Pattern: Adult Expression: unidentified cells in tail ; Larval Expression: unidentified cells in tail

• Primary Identifier: Expr1020014
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1156297
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2013641
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2031875
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

25 GO Annotation

4 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003384
• Start: 10136129
• End: 10138620
• Strand: -1

25 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2492

1 Sequence Ontology Term