WormMine: ExpressionPattern Expr6177

• Pattern: Adult Expression: pharynx; intestine; rectal gland cells; head mesodermal cell; Nervous System; head neurons; neurons along body; PVT interneuron; Embryo Expression: intestine; Larval Expression: pharynx; intestine; rectal gland cells; head mesodermal cell; Nervous System; head neurons; neurons along body; PVT interneuron
• Primary Identifier: Expr6177
• Remark: Also expressed in (comments from author) : No comments. Strain: BC11202
• Reporter Gene: [alh-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGCCGAAGTGGATTTTGTTCT] 3' and primer B 5' [GAGAGCTGAACGGAGGATTC] 3'.

8 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages.	intestine	gut	WBbt:0005772
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
Neuron class of one interneuron, projects along ventral cord to ring.	PVT	lineage name: ABplpappppa	WBbt:0004070
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses.	neuron	neurone	WBbt:0003679
	rectal gland cell		WBbt:0005799
Head mesodermal cell, function unknown	head mesodermal cell	hmc	WBbt:0004697

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00000107	alh-1	F54D8.3	Caenorhabditis elegans

3 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	The whole period of embryogenesis in the nematode Caenorhabditis elegans, from the formation of an egg until hatching.		embryo Ce	WBls:0000003
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023