WormMine: ExpressionPattern Expr6071

• Pattern: Adult Expression: stomato-intestinal muscle; hypodermis; Nervous System; head neurons; amphids; Larval Expression: stomato-intestinal muscle; hypodermis; Nervous System; head neurons; amphids
• Primary Identifier: Expr6071
• Remark: Strain: BC15650
• Reporter Gene: [F44E7.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAAAAGGTAATCATCAGCTTGAA] 3' and primer B 5' [ATAGTTGGGTACTTGATTTTCTGA] 3'.

6 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
Epidermal layer.	hypodermis	epidermis	WBbt:0005733
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
neuron of the amphid sensillum	amphid neuron	amphid sensory neuron	WBbt:0005394
left intestinal muscle cell, attach to intestine and body wall anterior to anus	mu_int_L	lineage name: ABplpppppaa	WBbt:0003833
right intestinal muscle cell, attach to intestine and body wall anterior to anus	mu_int_R	lineage name: MSppaapp	WBbt:0003822

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00018424	pgph-2	F44E7.2	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023