WormMine: ExpressionPattern Expr7077

• Pattern: Adult Expression: pharynx; Reproductive System; uterus; body wall muscle; Larval Expression: pharynx; Reproductive System; developing uterus; body wall muscle; unidentified cells in body
• Primary Identifier: Expr7077
• Remark: Also expressed in (comments from author) : unidentified tissue in the body is part of the reproductive system Strain: BC14533
• Reporter Gene: [Y57G11C.12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTTCAAGAAATACAGTACCCCAC] 3' and primer B 5' [CGAAAGAGTATCTCCTTTGGTGA] 3'.

5 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion.	body wall musculature	body muscle	WBbt:0005813
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
The organ in which the eggs are developed and protected until laid.	uterus		WBbt:0006760
	reproductive system		WBbt:0005747
region of the body by which tissues, cells or cell parts are classified	body region		WBbt:0005738

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00013308	nuo-3	Y57G11C.12	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023