WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00000450 Gene Name  ceh-28
Sequence Name  ? K03A11.3 Brief Description  ceh-28 encodes a homeodomain protein of the NK-2 family; ceh-28 is expressed in a single pharyngeal neuron, M4; within M4, CEH-28 functions to positively regulate the expression of dbl-1, which encodes a TGF-beta, and hence, TGF-beta signaling to ensure proper morphology of the pharyngeal g1 gland cells that are located adjacent to M4.
Organism  Caenorhabditis elegans Automated Description  Enables RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Involved in positive regulation of transcription by RNA polymerase II and regulation of neuron differentiation. Located in chromatin. Expressed in several structures, including ABalaappa; ABalaappaa; ABalaappap; ABalapapa; and M4 neuron. Human ortholog(s) of this gene implicated in several diseases, including aortic valve disease 2; congenital heart disease (multiple); and heart conduction disease (multiple). Is an ortholog of human NKX2-5 (NK2 homeobox 5).
Biotype  SO:0001217 Genetic Position  X :10.2061 ±0.074367
Length (nt)  ? 1420
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00000450

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:K03A11.3.1 K03A11.3.1 720   X: 13074673-13076092
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:K03A11.3 K03A11.3 606   X: 13074682-13074904

2 RNAi Result

WormBase ID
WBRNAi00049786
WBRNAi00016509

27 Allele

Public Name
gk964260
gk964029
gk962707
gk964028
gk963810
gk963581
WBVar01691339
WBVar01691338
gk297781
WBVar01825294
WBVar00217098
WBVar01572151
WBVar01572150
gk395680
gk775716
gk551417
WBVar01835242
gk544131
tm1258
WBVar01954950
WBVar01941568
WBVar01988095
ok1833
gk687834
gk754691
WBVar02123866
cu11

1 Chromosome

WormBase ID Organism Length (nt)
X Caenorhabditis elegans 17718942  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00000450 13074673 13076092 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrX_13076093..13078198   2106 X: 13076093-13078198 Caenorhabditis elegans

35 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_upregulated
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Coexpression clique No. 203, sre-33-ZK1025.1_8337, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:sre-33-ZK1025.1_8337
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 0hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:germline-precursors_blastula-embryo_expressed
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
Bacteria infection: Serratia marcescens Genes with increased expression after 24 hours of infection by S.marcescens Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:S.marcescens_24hr_upregulated_TilingArray
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:bodywall-muscle_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:intestine_L1-larva_expressed
  Genes that showed significantly decreased experssion after 22.5 hours of treatment in 200nM delta7-dafachronic acid comparing with in ethanol vehicle control. To identify the differentially expressed genes, we applied Significance Analysis of Microarrays (SAM) analysis using the R package samr [46]. Genes with median false discovery <5% and fold changes >2.0 were considered differentially expressed. WBPaper00046548:dafachronic-acid_downregulated
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 0hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:BAG-neuron_blastula-embryo_expressed
  Genes from eat-2(ad465) animals with significantly increased expression after 72 hours of treatment on growth media with 10uM rapamycin in 2% DMSO. Analysis of gene expression data was carried out with the Affymetrix Transcriptome Analysis Console. Data preprocessing (using RMA normalization) and QC metrics were performed using Affymetrix Expression Console TM and manually inspected afterwards. Expression analysis was carried out for each two pairwise conditions. FDR statistical correction for multiple testing resulted in a slightly lower number of DEGs in most cases. P-value < 0.05 and fold change > 2.0 were used to determine differentially expressed genes. WBPaper00048989:eat-2(ad465)_rapamycin_upregulated
Bacteria infection: Photorhabdus luminescens Genes with increased expression after 24 hours of infection by P.lumniescens Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:P.lumniescens_24hr_upregulated_RNAseq
Bacteria infection: Enterococcus faecalis Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:E.faecalis_24hr_upregulated_RNAseq
  Transcripts that showed significantly increased expression in mex-1(or286) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. RPKM fold change > 2. WBPaper00058598:mex-1(or286)_upregulated
  Transcripts that showed significantly increased expression in mex-3(eu149) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. RPKM fold change > 2. WBPaper00058598:mex-3(eu149)_upregulated
  Transcripts that showed significantly increased expression in spn-4(tm291) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. RPKM fold change > 2. WBPaper00058598:spn-4(tm291)_upregulated
  Top 300 transcripts enriched in pm1, pm2 according to single cell RNAseq. Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm. WBPaper00061340:pm1_pm2
  Genes in the bottom 10% of expression level across the triplicate L3 samples. To generate the top10 and bottom10 gene sets, authors ranked all genes by mean expression array signal intensity across the three replicates, then took the top and bottom deciles (1,841 genes each) to represent genes with high and low expression. To generate the top10 and bottom10 gene sets, authors ranked all genes by mean expression array signal intensity across the three replicates, then took the top and bottom deciles (1,841 genes each) to represent genes with high and low expression. WBPaper00032528:L3_depleted
  Genes that showed significantly decreased expression in ubc-9(RNAi) animals comparing to control RNAi animals. N.A. WBPaper00045390:ubc-9(RNAi)_downregulated
  Genes up-regulated after 24 hour exposure to colistin. Gene lists were created using a cutoff P-value of < 0.05, 2-fold change. WBPaper00045673:colistin_upregulated
  Single-cell RNA-Seq cell group 51_1 expressed in neuron. scVI 0.6.0 WBPaper00065841:51_1
control(maintained under normal lab light (mostly dark, in incubators).) vs UVC-EtBr-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total) and exposed to EtBr (5ug/mL in agar).) at 3 h after the first UVC dose (3h). Genes differentially expressed in control vs after UVC exposure and EtBr treatment at the -45h timepoint (3 hours after the first UVC dose). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:control_vs_UVC-EtBr-exposed_3h
control(maintained under normal lab light (mostly dark, in incubators).) vs UVC-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total).) at 3 h after the first UVC dose (3h). Genes differentially expressed in control vsafter UVC exposure without EtBr treatment, at the -45h timepoint (3 hours after the first UVC dose). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:control_vs_UVC-exposed_3h
  Single-cell RNA-Seq cell group 126_0 expressed in neuron. scVI 0.6.0 WBPaper00065841:126_0
  Top 300 transcripts enriched in ALML, ALMR, PLML, PLMR according to single cell RNAseq. Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm. WBPaper00061340:ALM_PLM
  Top 300 transcripts enriched in g1AL, g1AR, g1P according to single cell RNAseq. Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm. WBPaper00061340:g1A_g1P
  Enriched in intestinal (adult).   WBPaper00029359_1280
  Enriched in intestinal (adult).   WBPaper00029359_1444
  Enriched in intestinal (adult).   WBPaper00029359_1504

13 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2009873 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC12998 [ceh-28::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATGGGTAGCAACAGATGTGAA] 3' and primer B 5' [TGCGTAGATTGGATTGGGA] 3'. Expr6310 Adult Expression: Nervous System; head neurons; Larval Expression: Nervous System; head neurons;  
Also expressed in (comments from author) : Expresses in NSM neuron(s) Strain: BC10951 [ceh-28::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATGGGTAGCAACAGATGTGAA] 3' and primer B 5' [TGCGTAGATTGGATTGGGA] 3'. Expr6311 Adult Expression: Nervous System; head neurons; pharyngeal neurons; Larval Expression: Nervous System; head neurons; pharyngeal neurons;  
Picture: Figure 3A to 3G.   Expr7888 In all lines, GFP expression was observed exclusively in the M4 pharyngeal neuron from the 2-fold stage [~450 min post first cleavage (pfc)] through adulthood. In earlier embryos prior to pharyngeal formation, strong and reproducible GFP was also observed in a cell called ABalaappa beginning at 172 min pfc and continuing in the daughters of this cell. The anterior daughter of this cell undergoes pro- grammed cell death, whereas the posterior daughter (called ABalaappap) continues to express GFP until at least 350 min pfc, before dividing to produce the AVAR ventral cord interneuron and the OLQsoVR socket cell. Weak and variable expression was also observed in other cells including ABalapap(a/p).  
Clone: pUL#JRH9C4   Expr7605 From late embryo to adult, expression is seen in a single nerve in the pharynx, possibly M4.  
    Expr1153501 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr15578    
    Expr2028113 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1170009 Time-lapse fluorescence microscopy was performed, including DIC for morphology. Gene expression patterns were summarized in 4 manners: Average over time, Average over time and at different positions along the anterior-posterior (AP) axis, a voxelized representation over time, and on individual cells overlaid from a reference coordinate dataset (https://doi.org/10.1016/j.ydbio.2009.06.014). The analysis was done with a pipeline based on the multi-purpose image analysis software Endrov (https://doi.org/10.1038/nmeth.2478), which further is needed to browse the raw recording data. Thumbnail movies were also generated, using maximum Z projection for the 3D fluorescence channel. Raw recordings available in the Endrov OST-file format are available at https://www.ebi.ac.uk/biostudies/studies/S-BIAD191?query=S-BIAD191  
Original chronogram file: chronogram.38.xml [K03A11.3:gfp] transcriptional fusion. Chronogram1506    
Original chronogram file: chronogram.2160.xml [K03A11.3:gfp] transcriptional fusion. Chronogram1096    
Original chronogram file: chronogram.88.xml [K03A11.3:gfp] transcriptional fusion. Chronogram1962    
    Expr1016357 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

24 GO Annotation

Annotation Extension Qualifier
  enables
  enables
  acts_upstream_of
  involved_in
  involved_in
  enables
  involved_in
  enables
  enables
  enables
  enables
  involved_in
  located_in
  involved_in
has_input(WB:WBGene00000936),occurs_in(WBbt:0004467) involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  located_in
  located_in
  located_in
  located_in
  located_in

22 Homologues

Type
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00000450 13074673 13076092 1

24 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables
  acts_upstream_of
  involved_in
  involved_in
  enables
  involved_in
  enables
  enables
  enables
  enables
  involved_in
  located_in
  involved_in
has_input(WB:WBGene00000936),occurs_in(WBbt:0004467) involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  located_in
  located_in
  located_in
  located_in
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
1420

1 Sequence Ontology Term

Identifier Name Description
gene  

5 Strains

WormBase ID
WBStrain00029949
WBStrain00032224
WBStrain00052007
WBStrain00002444
WBStrain00001573

0 Upstream Intergenic Region