WormMine: Gene WBGene00001650

• WormBase Gene ID: WBGene00001650
• Gene Name: gon-1
• Sequence Name: F25H8.3
• Brief Description: gon-1 encodes a functional metalloprotease that defines a new sub-family of secreted proteases known as MPT (metalloprotease with thrombospondin type 1 repeats); the other two members of this family are the bovine procollagen I N-protease ( PINP ) and the murine enzyme ADAMTS-1; gon-1 is essential for hermaphrodite gonadal morphogenesis and sequence homology with other metalloproteases suggests that it functions by remodeling the extracellular matrix; gon-1 is also required for protein transport from the endoplasmic reticulum (ER) to the Golgi, a function dependent on its C-terminal GON domain; GON-1 is expressed at high levels within the gonadal distal tip cell during migration and also in body wall muscle cells; in the distal tip cell, reporter fusion constructs expressing the GON domain localize to the endoplasmic reticulum, suggesting that GON-1 functions both intra- and extracellularly.
• Organism: Caenorhabditis elegans
• Automated Description: Enables metallopeptidase activity. Involved in several processes, including endoplasmic reticulum to Golgi vesicle-mediated transport; muscle organ morphogenesis; and negative regulation of presynapse assembly. Predicted to be located in extracellular matrix. Expressed in amphid neurons; excretory cell; gonad; motor neurons; and muscle cell. Used to study obesity and type 2 diabetes mellitus. Human ortholog(s) of this gene implicated in rheumatoid arthritis. Is an ortholog of human ADAMTS20 (ADAM metallopeptidase with thrombospondin type 1 motif 20) and ADAMTS9 (ADAM metallopeptidase with thrombospondin type 1 motif 9).
• Biotype: SO:0001217
• Genetic Position: IV :4.4533 ±0.0006
• Length (nt): 19228

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001650

Genomics

4 Transcripts

Class	WormMine ID	Sequence Name	Length (nt)	Chromosome Location
MRNA	Transcript:F25H8.3a.2	F25H8.3a.2	7704	IV: 9934206-9946497
MRNA	Transcript:F25H8.3a.1	F25H8.3a.1	7818	IV: 9934206-9953433
MRNA	Transcript:F25H8.3b.1	F25H8.3b.1	6498	IV: 9935067-9945775
NcPrimaryTranscript	Transcript:F25H8.3c	F25H8.3c	6953	IV: 9935067-9953429

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F25H8.3a	F25H8.3a	6453	IV: 9935067-9935237
CDS:F25H8.3b	F25H8.3b	6498	IV: 9935067-9935237

25 RNAi Result

• WBRNAi00045556
• WBRNAi00045559
• WBRNAi00025235
• WBRNAi00008700
• WBRNAi00099925
• WBRNAi00100400
• WBRNAi00117501
• WBRNAi00090970
• WBRNAi00100774
• WBRNAi00099319
• WBRNAi00099521
• WBRNAi00099723
• WBRNAi00101113
• WBRNAi00065788
• WBRNAi00065716
• WBRNAi00091462
• WBRNAi00100026
• WBRNAi00100213
• WBRNAi00089058
• WBRNAi00100587
• WBRNAi00100961
• WBRNAi00101180
• WBRNAi00110306
• WBRNAi00117247
• WBRNAi00117506

221 Allele

• gk964278
• gk964078
• gk964500
• gk962765
• q518
• gk765388
• gk328454
• gk327052
• gk347425
• gk209892
• gk715357
• gk455413
• gk209902
• WBVar00246250
• WBVar01609462
• WBVar02021081
• gk946525
• tm3146
• WBVar01795109
• WBVar01795108
• WBVar01581732
• gk959536
• WBVar00191606
• WBVar00191609
• WBVar00191610
• WBVar00191607
• WBVar02041961
• WBVar00191608
• WBVar00191611
• WBVar00191612

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001650
• Start: 9934206
• End: 9953433
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

167 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Coexpression clique No. 60, 176662_at-Y53F4B.16, on the genome-wide coexpression clique map for the nematode GPL200 platform.	All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform.	WBPaper00061527:176662_at-Y53F4B.16
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
Bacteria infection: Bacillus thuringiensis	Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304.	N.A.	WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_hrde-1(tm1200)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
Bacteria infection: Staphylococcus aureus	Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals not colonized by microbiota and not infected by pathogen.	DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05.	WBPaper00067479:Microbiota-Pathogen_vs_control_downregulated
Bacteria infection: Staphylococcus aureus	Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals not colonized by microbiota but infected by pathogen.	DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05.	WBPaper00067479:Microbiota-Pathogen_vs_Pathogen_downregulated
	Transcripts that showed significantly decreased expression in N2 day 7 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq.	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day7_vs_Day1_downregulated_Illumina
	Transcripts that showed significantly decreased expression in N2 day 10 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq.	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day10_vs_Day1_downregulated_Illumina
	Transcripts that showed significantly decreased expression in N2 day 15 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq.	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day15_vs_Day1_downregulated_Illumina
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome

11 Expression Patterns

• Primary Identifier: Expr1030990
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr5865
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC13313
• Reporter Gene: [gon-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTCAGAATGAACAAAGGGGGT] 3' and primer B 5' [CGGATACCAACAGCTCCG] 3'.
• Pattern: Adult Expression: anal sphincter; Reproductive System; vulval muscle; spermatheca; body wall muscle; head mesodermal cell; Nervous System; head neurons; tail neurons; Larval Expression: anal sphincter; body wall muscle; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr1330
• Pattern: In hermaphrodites, GFP is not observed in gonads from first-stage(L1) larvae. Its first gonadal expression occurs in L2 and is limited to the DTCs. GFP continues to be expressed in DTCs through L4, but is faint or not detectable in the adult. GFP is similarly expressed in the male linker cell. In addition to its expression in leader cells, the gon-1 promoter also drives GFP in muscle cells throughout development.

• Primary Identifier: Expr11980
• Pattern: gon-1 is highly expressed in most muscles in the worm. gon-1 expression was not observed in motor neurons.

• Primary Identifier: Expr12453
• Pattern: gon-1p::mCherry and daf-28p::GFP, which are expressed in ASI and ASJ neurons, were observed in the same cells.

• Primary Identifier: Expr12452
• Pattern: In addition to DTCs and body wall muscle cells, gon-1 is expressed in certain additional cell types at the larval and adult stages, including motor neurons at the adult stage, intestine at the L4 stage, vulval muscle, VC4 and VC5at the adult stage and excretory cells. gon-1 is also expressed in certain cells at the embryonic stage (260-280 min after the first cleavage).

• Primary Identifier: Expr1020929
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1149471
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2030406
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1542
• Remark: Original chronogram file: chronogram.414.xml
• Reporter Gene: [F25H8.3:gfp] transcriptional fusion.

• Primary Identifier: Expr2012170
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

32 GO Annotation

23 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001650
• Start: 9934206
• End: 9953433
• Strand: -1

32 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 19228

1 Sequence Ontology Term

• Name: gene

6 Strains

• WBStrain00022613
• WBStrain00022578
• WBStrain00050795
• WBStrain00054932
• WBStrain00054931
• WBStrain00004564

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_9953434..9953797
• Length (nt): 364
• Chromosome Location: IV: 9953434-9953797
• Organism: Caenorhabditis elegans